SubtiWiki SubtiWiki
yjhA

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yjhA
168

lipoprotein

locus
BSU_12180
Molecular weight
23.83 kDa
pI
5.29
Protein length
Gene length
function
unknown
product
lipoprotein
essential
no
synonyms
yjhA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,289,298  1,289,939
The protein
[wiki|Domains]
[wiki|DUF4352] (aa 64 ... 194) (according to UniProt)
Structure
[PDB|3CFU]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|772A05040C46912B9FDEE4F4F817CE0C92EC7C1A|yjhA]-[gene|FF6A150806407E7D10C090FA2CDB521DDC7811F9|yjhB]
description
[pubmed|22383849]
Open in new tab

[gene|772A05040C46912B9FDEE4F4F817CE0C92EC7C1A|yjhA]→[gene|FF6A150806407E7D10C090FA2CDB521DDC7811F9|yjhB]

2021-11-05 18:35:11

Jstuelk

4

d943e61307b627fe456c9975bb9291600aff4190

B314D413E80BB31098006A904EAF344B6AA4A4AD

genes
[gene|772A05040C46912B9FDEE4F4F817CE0C92EC7C1A|yjhA]
description
[pubmed|22383849]
Open in new tab

[gene|772A05040C46912B9FDEE4F4F817CE0C92EC7C1A|yjhA]

2021-07-02 02:08:46

Jstuelk

1

19cac326d9e012f71411f58615c26fd7294cf147

F775E0BE39E057D1093A6389CCB69FF709D17A92

Biological materials
Mutant
MGNA-A353 (yjhA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/353 NBRP B. subtilis, Japan]
BKE12180 ([gene|772A05040C46912B9FDEE4F4F817CE0C92EC7C1A|yjhA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12180 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATTGTTCCCCCATCTA,  downstream forward: _UP4_TAGATGCTAATTTACAGTTG
BKK12180 ([gene|772A05040C46912B9FDEE4F4F817CE0C92EC7C1A|yjhA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12180 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATTGTTCCCCCATCTA,  downstream forward: _UP4_TAGATGCTAATTTACAGTTG
References
27766092

772A05040C46912B9FDEE4F4F817CE0C92EC7C1A

Page visits: 833

Time of last update: 2022-01-19 17:28:10

Author of last update: Melvin.boenninger