yaaH

yaaH
168

general stress protein, survival of ethanol stress, [protein|CEBEC9CECCF445C40D793E61A2CD23175631A473|safA]-dependent protein of the inner spore coat, spore cortex lytic protein

locus
BSU_00160
Molecular weight
48.47 kDa
pI
5.62
Protein length
Gene length
function
survival of ethanol stress, protection of the spore
product
N-acetylglucosaminidase
essential
no
synonyms
yaaH, sleL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3858

This gene is a member of the following regulons

Gene
Coordinates
23,868  25,151
The protein
Protein family
[wiki|Glycosyl hydrolase 18 family] (according to UniProt)
Chitinase class II subfamily (with [protein|DFA0BFED9FC2C47ABAA2284514CE2F81BD9EDFEF|ydhD], according to UniProt)
[wiki|Domains]
contains two N-acetylglucosamine-polymer-binding [wiki|LysM domain]s at the N-terminus (aa 2-46, aa 51-95) [Pubmed|18430080]
[wiki|glycoside hydrolase family 18 domain] (aa 125 to 410)
[wiki|LysM domain] 1 (aa 2-46) (according to UniProt)
[wiki|LysM domain] 2 (aa 51-95) (according to UniProt)
Structure
[PDB|4S3K] (SleL from B. megaterium, 55% identity) [pubmed|26190134]
[AF|P37531]
Paralogous protein(s)
[protein|DFA0BFED9FC2C47ABAA2284514CE2F81BD9EDFEF|ydhD]
[wiki|Localization]
inner spore coat, localization depends on [protein|CEBEC9CECCF445C40D793E61A2CD23175631A473|safA] [Pubmed|19933362,22171814]
Additional information
required for survival of ethanol stress [Pubmed|15805528]
Expression and Regulation
Operons
genes
[gene|77BEC74867422AA225A1F12AD63464656DBDCBE8|yaaH]
description
[Pubmed|10419957]
regulation
expressed during sporulation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE], [wiki|SpoIIID]) [Pubmed|15383836,10419957]
expression
expression is heterogeneous [pubmed|35171018]
regulatory mechanism
[protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|spoIIID]: repression, [Pubmed|15383836], in [regulon|protein:90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|spoIIID regulon]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|15699190,10419957], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
additional information
the mRNA is very stable (half-life > 15 min) [pubmed|12884008]
Open in new tab

[gene|77BEC74867422AA225A1F12AD63464656DBDCBE8|yaaH]

2022-12-01 05:41:38

Jstuelk

48

6C2EA0767CD9813D646A11339267863E83C103BC

46797B3A0D0A1D4A0B32228B3F4E07E29E0A3694

genes
[gene|95C78F511C49E04241D31593E6837BDFF48D6E14|yaaI]-[gene|77BEC74867422AA225A1F12AD63464656DBDCBE8|yaaH]
description
[pubmed|22383849]
regulation
induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]) [Pubmed|15805528]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|95C78F511C49E04241D31593E6837BDFF48D6E14|yaaI]->[gene|77BEC74867422AA225A1F12AD63464656DBDCBE8|yaaH]

2022-12-03 08:56:43

Bzhu

39

7c59ed067cd9702eeafbb90cc255468664f43fed

92E7FFF049039C116E6130CE3D2C724CE041EF9E

Biological materials
Mutant
MGNA-B889 (yaaH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1888 NBRP B. subtilis, Japan]
BKE00160 ([gene|77BEC74867422AA225A1F12AD63464656DBDCBE8|yaaH]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE00160 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACATAAATTTGAATGAAAA,  downstream forward: _UP4_TAATTTGGAAACGTCTTTTT
BKK00160 ([gene|77BEC74867422AA225A1F12AD63464656DBDCBE8|yaaH]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK00160 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACATAAATTTGAATGAAAA,  downstream forward: _UP4_TAATTTGGAAACGTCTTTTT
References
Reviews
18430080,23202530,35638784
Original Publications
19087206,12884008,10419957,15805528,11964120,19933362,22171814,15383836,22343356,18835992,26190134,30455281,35171018

77BEC74867422AA225A1F12AD63464656DBDCBE8

Page visits: 3204

Time of last update: 2022-12-08 21:45:27

Author of last update: Jstuelk