comA

comA
168

two-component system response regulator, controls gene expression in response to cell density (concentration of [protein|60D6EB02923D9ADE88F61A8CBBD882BA8BDD457E|comX])

locus
BSU_31680
Molecular weight
23.98 kDa
pI
4.76
Protein length
Gene length
function
regulation of genetic competence and quorum sensing
product
two-component system response regulator
essential
no
ec
4.4.1.19
synonyms
comA, srfB, comAA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2197

This gene is a member of the following regulons

Gene
Coordinates
3,252,804  3,253,448
The protein
[wiki|Domains]
[wiki|Response regulatory domain] (aa 3-121) (according to UniProt)
[wiki|HTH luxR-type domain] (aa 147-212) (according to UniProt)
Structure
[PDB|1U83]
[PDB|3ULQ] (structure of the complex between the DNA-binding C-terminal domain of [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA] with [protein|1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D|rapF]) [Pubmed|22215984]
[AF|P14204]
Modification
phosphorylated by [protein|5A00E233F0B5A0DAB18D2ECC55527F1911987F86|comP] on an Asp residue
Effectors of protein activity
phosphorylation activates DNA binding
DNA-binding activity of ComA is inhibited by [protein|242632B27E0E3AB15777E9FBA3FC746D00CE97F9|rapC] [Pubmed|12950917], [protein|4670F7C4CB9084A5BA478CAE238FA0F8C39F3A7E|rapD] [Pubmed|17227471], [protein|1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D|rapF] [Pubmed|15968044,22215984], [protein|BA85E2C2E2A6B76FAFA31EBDBF466324C9B021C8|rapH] [Pubmed|17581123] and [protein|C8BF3815578293542D14811C60F4CA78AACF73EB|rapK] [Pubmed|16816200]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|FDACEF9DDC3BEA4EB013AE67BC47ADA532F00205|comQ]-[gene|60D6EB02923D9ADE88F61A8CBBD882BA8BDD457E|comX]-[gene|5A00E233F0B5A0DAB18D2ECC55527F1911987F86|comP]-[gene|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]-[gene|015989AAB862E418C944AB35DA3605863F059CE9|yuxO]
description
[Pubmed|22383849]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|2507523], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|FDACEF9DDC3BEA4EB013AE67BC47ADA532F00205|comQ]→[gene|015989AAB862E418C944AB35DA3605863F059CE9|yuxO]

2022-12-02 09:08:04

Jstuelk

45

150fea5ac7a55e0a32a0fafb306d0c860c9a2be7

E73017881E40042997BB444071E259402A0F5D1F

Biological materials
Mutant
BKE31680 ([gene|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE31680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTCCTCCCTTTTAC,  downstream forward: _UP4_CTTTAAATGTTGGGGGGTGT
BKK31680 ([gene|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK31680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTCCTCCCTTTTAC,  downstream forward: _UP4_CTTTAAATGTTGGGGGGTGT
References
Reviews
20030732,12576575,30218468
Original Publications
17227471,11133937,2116363,12067344,8387999,19202088,10094672,8643670,11267663,15968044,16816200,10447896,12950917,20302877,12270822,17581123,2507523,20208433,22215984,24130811,24425772,24788106,25598361,25757097,26582911,26787913,26927849,28033323

7832489F11F606BCF637EC23BAAB41AD10237EBB

Page visits: 6502

Time of last update: 2022-12-08 17:21:45

Author of last update: Melvin.boenninger