comEA

comEA
168

membrane DNA receptor, plays an important role in the transfer of transforming DNA into the DNA channel and in controlling the rate of DNA uptake

locus
BSU_25590
Molecular weight
21.62 kDa
pI
4.82
Protein length
Gene length
function
genetic competence
product
membrane DNA receptor
essential
no
ec
null
synonyms
comEA, comD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1555

This gene is a member of the following regulons

Gene
Coordinates
2,640,513  2,641,130
Phenotypes of a mutant
strongly reduced transformation rate [Pubmed|22398145]
The protein
Catalyzed reaction/ biological activity
stabilizes the attachment of transforming DNA at localized regions in the periplasm and then mediates uptake, probably by a Brownian ratchet mechanism [pubmed|34126763]
[wiki|Domains]
extracellular DNA-binding domain
2 HhH domains (aa 142-171,aa 172-302) (according to UniProt)
Structure
[PDB|2DUY] (from ''Thermus thermophilus hb8'', 37% identity, 60% similarity)
[AF|P39694]
[wiki|Localization]
cell membrane (integral), no distinct position [Pubmed|34928178,24164455,21278288]
Expression and Regulation
Operons
genes
[gene|788725411B2E741103603373E43441FD036E1BA0|comEA]-[gene|954359717E15DFC106A9D8111C6637E46B16F8C9|comEB]-[gene|363C6FE07C5E56FDE6BEC6ACFBA1A5535F0F64AC|comEC]
description
[Pubmed|7968523,19028902]
regulatory mechanism
[protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK]: activation, [Pubmed|8196543], in [regulon|protein:08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|7968523], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|788725411B2E741103603373E43441FD036E1BA0|comEA]→[gene|363C6FE07C5E56FDE6BEC6ACFBA1A5535F0F64AC|comEC]

2022-11-29 06:09:41

ghost

38

86f3e687bb54836ace615fef7894da50ba4cc85a

45A6B709534D0EE24B7E982999D607F68BD6A18E

Other regulations
[protein|F21A75744FA0B25D5A251CB57E7A7DC6ABFF1DC7|comN]: unknown, [pubmed|19028902]
Biological materials
Mutant
BKE25590 ([gene|788725411B2E741103603373E43441FD036E1BA0|comEA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE25590 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGTGCATGTTCCCCGCT,  downstream forward: _UP4_TGATTTGACGGTCATGCATT
BKK25590 ([gene|788725411B2E741103603373E43441FD036E1BA0|comEA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK25590 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGTGCATGTTCCCCGCT,  downstream forward: _UP4_TGATTTGACGGTCATGCATT
References
Reviews
15083159,31950915
Original Publications
9987128,11814663,7768800,16751195,7968523,17630974,21278288,19028902,21707789,22398145,24164455,34126763,34928178

788725411B2E741103603373E43441FD036E1BA0

Page visits: 4089

Time of last update: 2022-11-29 06:53:31

Author of last update: Jstuelk