mdtR

mdtR
168

transcription repressor of the multidrug-resistance [gene|795D70E8A4D750140D6B1AA4BFEBD25C2A389C85|mdtR]-[gene|search|mdtP ]operon

locus
BSU_32870
Molecular weight
17.26 kDa
pI
6.38
Protein length
Gene length
function
regulation of the multidrug-resistance [gene|795D70E8A4D750140D6B1AA4BFEBD25C2A389C85|mdtR]-[gene|search|mdtP ]operon
product
transcription repressor ([wiki|MarR family])
essential
no
synonyms
mdtR, yusO

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1846

This gene is a member of the following regulons

Gene
Coordinates
3,374,492  3,374,959
The protein
Protein family
[wiki|MarR family]
[wiki|Domains]
[wiki|HTH marR-type domain] (aa 4-140) (according to UniProt)
Structure
[PDB|1S3J]
[AF|O32181]
Expression and Regulation
Operons
genes
[gene|795D70E8A4D750140D6B1AA4BFEBD25C2A389C85|mdtR]-[gene|45C61C1584A851676F15A2249F3F1092863C5AA5|mdtP]
description
[Pubmed|19286808]
regulatory mechanism
[protein|795D70E8A4D750140D6B1AA4BFEBD25C2A389C85|mdtR]: repression, [Pubmed|19286808], in [regulon|protein:795D70E8A4D750140D6B1AA4BFEBD25C2A389C85|mdtR regulon]
Open in new tab

[gene|795D70E8A4D750140D6B1AA4BFEBD25C2A389C85|mdtR]→[gene|45C61C1584A851676F15A2249F3F1092863C5AA5|mdtP]

2022-06-09 04:16:12

ghost

10

e8ef0633959f1f2e66057727f720be97f7312a4d

F311909F49C8D0FC01C8D2C80963778BC55777F7

Biological materials
Mutant
MGNA-B595 (yusO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1594 NBRP B. subtilis, Japan]
GP1115 (spc), available in [wiki|Jörg Stülke]'s lab
BKE32870 ([gene|795D70E8A4D750140D6B1AA4BFEBD25C2A389C85|mdtR]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32870 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTCATTTCCCCTCTGT,  downstream forward: _UP4_CAAAACATGAAAAGAGGAAA
BKK32870 ([gene|795D70E8A4D750140D6B1AA4BFEBD25C2A389C85|mdtR]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32870 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTCATTTCCCCTCTGT,  downstream forward: _UP4_CAAAACATGAAAAGAGGAAA
References
19286808

795D70E8A4D750140D6B1AA4BFEBD25C2A389C85

Page visits: 1628

Time of last update: 2022-06-20 23:53:45

Author of last update: Melvin.boenninger