htrB

htrB
168

membrane-anchored protein quality control protease, serine protease, response to secretion and heat stresses

locus
BSU_33000
Molecular weight
48.55 kDa
pI
4.63
Protein length
Gene length
function
protein quality control
product
serine protease
essential
no
ec
3.4.21.107
synonyms
htrB, yvtA, yvtB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0265

This gene is a member of the following regulons

Gene
Coordinates
3,384,070  3,385,446
The protein
Catalyzed reaction/ biological activity
Acts on substrates that are at least partially unfolded. The cleavage site P1 residue is normally between a pair of hydrophobic residues, such as Val-|-Val (according to UniProt)
Protein family
Peptidase S1C family (with [protein|76FA52D5A5F9FCA14BA9B45872FE3D99D89B211B|htrA] and [protein|75B8C37E589C855D2BAD7FB51B9600E161ACFBD3|htrC], according to UniProt)
[wiki|Domains]
cytoplasmic domain (aa 1 - 71) (according to UniProt)
transmembrane helix (aa 72 - 92) (according to UniProt)
extracellular domain (aa 93 - 458) (according to UniProt)
[wiki|PDZ domain] (aa 350- 449) (according to UniProt)
Structure
[PDB|3QO6] (from ''Arabidopsis thaliana'', 38% identity) [Pubmed|21532594]
[AF|Q9R9I1]
[wiki|Localization]
cell membrane (according to UniProt)
randomly distributed in foci throughout the cell surface [Pubmed|22307758]
Expression and Regulation
Operons
genes
[gene|796216BE9CD6DADFEADC29497253C81BF496A2ED|htrB]
description
[Pubmed|22383849]
regulation
expressed under conditions of secretion stress ([protein|A40CD2C23A19860342F440284302EFFDAC09E88A|cssR]) [Pubmed|12270824]
regulatory mechanism
[protein|A40CD2C23A19860342F440284302EFFDAC09E88A|cssR]: activation, [Pubmed|12270824], in [regulon|protein:A40CD2C23A19860342F440284302EFFDAC09E88A|cssR regulon]
additional information
[protein|796216BE9CD6DADFEADC29497253C81BF496A2ED|htrB] is subject to degradation by [protein|DC0FDCA3FA6742B023E6877CE9554AA1D47012BB|wprA] and other extracellular proteases [PubMed|24362423]
Open in new tab

[gene|796216BE9CD6DADFEADC29497253C81BF496A2ED|htrB]

2022-12-29 19:27:11

Jstuelk

36

1bdf6477a0252008ca17ec508e821d917ca520de

A76E2442C553874A294760AC665F8984888782DE

Biological materials
Mutant
MGNA-B207 (yvtA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1206 NBRP B. subtilis, Japan]
BKE33000 ([gene|796216BE9CD6DADFEADC29497253C81BF496A2ED|htrB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE33000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTTACACTCCTTTA,  downstream forward: _UP4_TAAGAAAAAACAAAAAGCTG
BKK33000 ([gene|796216BE9CD6DADFEADC29497253C81BF496A2ED|htrB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK33000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTTACACTCCTTTA,  downstream forward: _UP4_TAAGAAAAAACAAAAAGCTG
References
Reviews
22688815,21326199,25212246,31001739,34410368
Original Publications
17600057,22307758,12270824,22092710,24362423,24115457,11133960,21532594,32111210

796216BE9CD6DADFEADC29497253C81BF496A2ED

Page visits: 2662

Time of last update: 2023-02-02 13:35:35

Author of last update: Jstuelk