lnrN

lnrN
168

similar to [wiki|ABC transporter] (membrane protein), involved in resistance to linearmycin

locus
BSU_08330
Molecular weight
41.92 kDa
pI
9.29
Protein length
Gene length
function
resistance to linearmycin
product
[wiki|ABC transporter] (membrane protein)
essential
no
synonyms
yfiN

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0842

This gene is a member of the following regulons

Gene
Coordinates
907,968  909,125
Phenotypes of a mutant
overexpression of [gene|07858BFC72EB0B6AF615C8D4C8BCC162D8C3E7D2|lnrM] and [gene|79BAF2329209C81E8D165F131F9DAADB4A81448A|lnrN] stimulates [wiki|biofilm formation ][pubmed|28461449]
The protein
Protein family
[wiki|ABC-2 integral membrane protein family] (according to UniProt)
[wiki|Domains]
[wiki|ABC transmembrane type-2 domain] (aa 163-382) (according to UniProt)
Structure
[AF|P94442]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|329E4DF9EF1545AABE485B9BBCD22F09ABF019A1|lnrL]-[gene|07858BFC72EB0B6AF615C8D4C8BCC162D8C3E7D2|lnrM]-[gene|79BAF2329209C81E8D165F131F9DAADB4A81448A|lnrN]
description
[Pubmed|26647299]
regulation
expression during spore [wiki|germination] is increased under conditions of osmotic stress [Pubmed|27766092]
induced in the presence of linearmycin and other polyenes ([protein|387EF370CE24F7A3C20789A57329A02EBED46F53|lnrK]) [pubmed|28461449]
regulatory mechanism
[protein|387EF370CE24F7A3C20789A57329A02EBED46F53|lnrK]: activation, [Pubmed|26647299], in [regulon|protein:387EF370CE24F7A3C20789A57329A02EBED46F53|lnrK regulon]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|329E4DF9EF1545AABE485B9BBCD22F09ABF019A1|lnrL]→[gene|79BAF2329209C81E8D165F131F9DAADB4A81448A|lnrN]

2022-11-25 06:01:29

Jstuelk

20

7fa1f47baf646398b2d2b81a08036e691ef5d550

3B045C04B4C45662F4875ADEB7A4D524530CAE31

Biological materials
Mutant
MGNA-C355 (yfiN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2353 NBRP B. subtilis, Japan]
BKE08330 ([gene|79BAF2329209C81E8D165F131F9DAADB4A81448A|lnrN]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE08330 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AATTTTTTTCACCTTTTGTA,  downstream forward: _UP4_TAAAAAACATCTGCCGTTTA
BKK08330 ([gene|79BAF2329209C81E8D165F131F9DAADB4A81448A|lnrN]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK08330 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AATTTTTTTCACCTTTTGTA,  downstream forward: _UP4_TAAAAAACATCTGCCGTTTA
References
10092453,26647299,28461449

79BAF2329209C81E8D165F131F9DAADB4A81448A

Page visits: 1346

Time of last update: 2022-12-01 01:16:31

Author of last update: Melvin.boenninger