

amino acid transporter (with [protein|C90D642197EE589F9D33CD5AA0B1069E3BC124A8|azlC])

Molecular weight
11.83 kDa
Protein length
Gene length
export of amino acids
component of amino acid transporter (with [protein|C90D642197EE589F9D33CD5AA0B1069E3BC124A8|azlC])
azlD, yrdI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1687

This gene is a member of the following regulons

2,728,647  2,728,979
The protein
Catalyzed reaction/ biological activity
export of some branched-chain amino acids (4-azaleucine) and of histidine (with [protein|C90D642197EE589F9D33CD5AA0B1069E3BC124A8|azlC]) [pubmed|36377869]
Protein family
AzlD/HI_1737/HP1330 family (single member, according to UniProt)
cell membrane (according to Swiss-Prot)
Expression and Regulation
repressed by [protein|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB] [Pubmed|36377869,9287000]
regulatory mechanism
[protein|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB]: repression, [Pubmed|36377869,9287000], in [regulon|protein:D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB regulon]
Open in new tab


2022-12-01 22:01:55





Biological materials
GP3601 (Δ[gene|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB]-[gene|C90D642197EE589F9D33CD5AA0B1069E3BC124A8|azlC]-[gene|7A1445B7AFD9C3AA45EF67E51F5D233FCC5F8884|azlD]::''kan'') , available in [wiki|Jörg Stülke]'s lab [pubmed|36377869]
GP3622 (Δ[gene|C90D642197EE589F9D33CD5AA0B1069E3BC124A8|azlC]-[gene|7A1445B7AFD9C3AA45EF67E51F5D233FCC5F8884|azlD]::''kan'') , available in [wiki|Jörg Stülke]'s lab [pubmed|36377869]
GP3623 (Δ[gene|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB]-[gene|C90D642197EE589F9D33CD5AA0B1069E3BC124A8|azlC]-[gene|7A1445B7AFD9C3AA45EF67E51F5D233FCC5F8884|azlD]::''spec'') , available in [wiki|Jörg Stülke]'s lab [pubmed|36377869]
BKE26700 ([gene|7A1445B7AFD9C3AA45EF67E51F5D233FCC5F8884|azlD]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGCTGCGTCATAGTCA,  downstream forward: _UP4_TAACCGATATCGGAAACGAT
BKK26700 ([gene|7A1445B7AFD9C3AA45EF67E51F5D233FCC5F8884|azlD]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGCTGCGTCATAGTCA,  downstream forward: _UP4_TAACCGATATCGGAAACGAT


Page visits: 1294

Time of last update: 2022-12-06 04:24:33

Author of last update: Jstuelk