

phosphoribosylglycinamide formyltransferase, irreversible

Molecular weight
21.63 kDa
Protein length
Gene length
purine biosynthesis
phosphoribosylglycinamide formyltransferase

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0299

This gene is a member of the following regulons

708,010  708,597
The protein
Catalyzed reaction/ biological activity
(6S)-10-formyltetrahydrofolate + N1-(5-phospho-D-ribosyl)glycinamide --> (6S)-5,6,7,8-tetrahydrofolate + H+ + N2-formyl-N1-(5-phospho-D-ribosyl)glycinamide (according to UniProt)
Protein family
GART family (single member, according to UniProt)
[PDB|3P9X] (from ''B. halodurans'', 51% identity, 70% similarity)
Paralogous protein(s)
Expression and Regulation
expression activated by glucose (4.4 fold) [Pubmed|12850135]
regulatory mechanism
G-box: termination, ([wiki|riboswitch]) [pubmed|3036807,12787499], in [regulon|other_regulator:G-box|G-box]
[protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|purR]: repression, (molecular inducer: PRPP) [Pubmed|7638212,2536750], in [regulon|protein:A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|purR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|3036807], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2022-09-11 08:43:11





Biological materials
BKE06510 ([gene|7B30F27D6C459437967A64467E52961F4A9E0F2C|purN]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE06510 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGATGCAAATACCGCAAACT,  downstream forward: _UP4_TTAAATAACAGAGGTGAAAA
BKK06510 ([gene|7B30F27D6C459437967A64467E52961F4A9E0F2C|purN]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK06510 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGATGCAAATACCGCAAACT,  downstream forward: _UP4_TTAAATAACAGAGGTGAAAA


Page visits: 56871

Time of last update: 2022-09-28 17:46:31

Author of last update: Melvin.boenninger