yezC

yezC
168

similar to transcriptional regulator ([wiki|Lrp family])

locus
BSU_06540
Molecular weight
9.30 kDa
pI
8.22
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yezC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1522 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
711,456  711,875
The protein
[wiki|Domains]
[wiki|HTH asnC-type domain] (aa 1-62) (according to UniProt)
Structure
[PDB|2P5V] (from Neisseria meningitidis, 33% identity) [pubmed|17374605]
[AF|O31497]
Expression and Regulation
Operons
genes
[gene|7B726F0FCE01A1F486D83B10D3F41A87B65F2DB5|yezC]
description
[Pubmed|22383849]
Open in new tab

[gene|7B726F0FCE01A1F486D83B10D3F41A87B65F2DB5|yezC]

2025-10-27 04:54:04

Jstuelk

76

7258bf4477e35f481bea4622c043e30de46492be

A727DA1372432DBDD6D0DEEA1B76BEA3B2594F37

Biological materials
Mutant
MGNA-A922 (yezC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/922 NBRP B. subtilis, Japan]
BKE06540 ([gene|7B726F0FCE01A1F486D83B10D3F41A87B65F2DB5|yezC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE06540 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGTCTGGCTCCTTTAC,  downstream forward: _UP4_TGATAACAAAAAACCCGCAG
BKK06540 ([gene|7B726F0FCE01A1F486D83B10D3F41A87B65F2DB5|yezC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK06540 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGTCTGGCTCCTTTAC,  downstream forward: _UP4_TGATAACAAAAAACCCGCAG
References
Research papers
17374605

7B726F0FCE01A1F486D83B10D3F41A87B65F2DB5

Page visits: 2227

Time of last update: 2025-10-28 23:36:33

Author of last update: Melvin.boenninger