rsfA

rsfA
168

probable regulator of transcription of [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]-dependent genes

locus
BSU_37620
Molecular weight
29.58 kDa
pI
5.13
Protein length
Gene length
function
control of expression of [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]-dependent genes
product
regulator of [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF] activity
essential
no
synonyms
rsfA, ywfN, ipa-92r

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5850

This gene is a member of the following regulons

Gene
Coordinates
3,861,437  3,862,213
Phenotypes of a mutant
inactivation of ''[gene|7C0458DB0E3E3AC952FB9DDBC4AD220A3A456359|rsfA]'' reduces sporulation efficiency to 11.6% that of wild type cells [Pubmed|26735940]
The protein
[wiki|Domains]
Myb-like domain (aa 1-57) (according to UniProt)
Structure
[AF|P39650]
[wiki|Localization]
forespore (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|7C0458DB0E3E3AC952FB9DDBC4AD220A3A456359|rsfA]
description
[Pubmed|7934828]
regulation
expressed during sporulation in the forespore ([protein|search|SigF]) [Pubmed|16497325,15699190,10629188]
regulatory mechanism
[protein|7C0458DB0E3E3AC952FB9DDBC4AD220A3A456359|rsfA]: repression, in [regulon|protein:7C0458DB0E3E3AC952FB9DDBC4AD220A3A456359|rsfA regulon]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|16497325,10629188], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|10629188], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|7C0458DB0E3E3AC952FB9DDBC4AD220A3A456359|rsfA]

2023-02-01 21:32:24

ghost

15

7dd74c4e2b56d9e3a26707b0f86a28856936d695

3EF223F9E18E40A7FC46F97637B4C8E59C8E3EFB

Biological materials
Mutant
MGNA-A592 (ywfN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/592 NBRP B. subtilis, Japan]
1S132 ( ''rsfA''::''tet''), [Pubmed|10629188], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S132&Search=1S132 BGSC]
BKE37620 ([gene|7C0458DB0E3E3AC952FB9DDBC4AD220A3A456359|rsfA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE37620 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTATCTCAACTCCCATT,  downstream forward: _UP4_TGACATAGAAAAATCCCAAA
BKK37620 ([gene|7C0458DB0E3E3AC952FB9DDBC4AD220A3A456359|rsfA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK37620 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTATCTCAACTCCCATT,  downstream forward: _UP4_TGACATAGAAAAATCCCAAA
References
Reviews
31350897,35638784
Original Publications
16497325,10629188,7934828,12107147,15699190,26735940

7C0458DB0E3E3AC952FB9DDBC4AD220A3A456359

Page visits: 2234

Time of last update: 2023-02-06 02:26:25

Author of last update: Jstuelk