dacA

dacA
168

Class C penicillin-binding protein 5, major D-alanyl-D-alanine carboxypeptidase

locus
BSU_00100
Molecular weight
48.47 kDa
pI
5.67
Protein length
Gene length
function
carboxypeptidase
product
penicillin-binding protein 5, D-alanyl-D-alanine carboxypeptidase
essential
no
synonyms
dacA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1686

This gene is a member of the following regulons

Gene
Coordinates
17,534  18,865
Phenotypes of a mutant
the mutant cells are thicker and shorter than wild type cells [pubmed|34846166]
sensitivity to most β-lactams, and strong resistance to vancomycin [pubmed|35758683]
defective in swarming motility (reduced rate of colony expansion) [pubmed|35638827]
The protein
Catalyzed reaction/ biological activity
Preferential cleavage: (Ac)(2)-L-Lys-D-Ala-|-D-Ala (according to UniProt)
Protein family
[wiki|Peptidase S11 family] (according to UniProt)
Structure
[PDB|1XP4] (from Streptococcus pneumoniae, 37% identity) [pubmed|15596446]
[AF|P08750]
Paralogous protein(s)
[protein|F7AD78F9AB98A150E8CDFC1D01A9F938FF9F8BD1|dacF]
[wiki|Localization]
secreted (according to Swiss-Prot)
membrane associated [Pubmed|18763711]
during vegetative growth: septal, distinct spots at periphery [pubmed|14731276]
Expression and Regulation
Operons
genes
[gene|7C3081BC8D416127A881627EB56C0628359111CF|dacA]-[gene|651D1E534490276B9BE7BFE7B5819176AE09891E|pdxS]-[gene|6F96C10759C1C20B3A6B396E3718F0A9281F100A|pdxT]-[gene|82B92D2FB8DB88689D3A8B77FAD2F63FCCA04C7E|serS]
description
[Pubmed|22383849]
regulation
the leader mRNA is processed upstream of [gene|7C3081BC8D416127A881627EB56C0628359111CF|dacA] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|ymcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|ylbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT] complex [Pubmed|29794222]
Open in new tab

[gene|7C3081BC8D416127A881627EB56C0628359111CF|dacA]→[gene|82B92D2FB8DB88689D3A8B77FAD2F63FCCA04C7E|serS]

2022-12-05 04:43:51

Jstuelk

58

4760e1ef503f91543fe562a8e6f81fd9fdcc9c0c

59F563C38B7236ABF3A723D4A694F254F7E01503

Biological materials
Mutant
1A742 ( ''dacA''::''cat''), [Pubmed|3087956], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A742&Search=1A742 BGSC]
1A743 ( ''dacA''::''cat''), [Pubmed|3087956], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A743&Search=1A743 BGSC]
BKE00100 ([gene|7C3081BC8D416127A881627EB56C0628359111CF|dacA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE00100 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATCGTACGACCTCCGTAT,  downstream forward: _UP4_TAATCAATTGAAAGAGCTCT
BKK00100 ([gene|7C3081BC8D416127A881627EB56C0628359111CF|dacA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK00100 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATCGTACGACCTCCGTAT,  downstream forward: _UP4_TAATCAATTGAAAGAGCTCT
GFP fusion
2085 [gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]2 [gene|7C3081BC8D416127A881627EB56C0628359111CF|dacA]::pSG1493 (cat Pxyl-gfpa-[gene|7C3081BC8D416127A881627EB56C0628359111CF|dacA]1-423) [pubmed|14731276], available in [wiki|Dirk Jan Scheffers]' lab and in the [http://bgsc.org BGSC]
References
Reviews
18266855,33709487
Original Publications
9864321,18763711,14731276,10383963,23531131,23199363,26499795,15596446,29794222,34846166,35638827,35758683

7C3081BC8D416127A881627EB56C0628359111CF

Page visits: 4232

Time of last update: 2022-12-05 11:05:32

Author of last update: Jstuelk