spoIIE

spoIIE
168

protein serine phosphatase, septum-associated PP2C, dephosphorylation of [protein|3936E91C062074BFE4284B54A8CC33F35F94F5EE|spoIIAA], required for the localization of [protein|672EA84D7725BE21F649DF30A11EB4E0EDFC3925|ftsA]-[protein|41872E2EF00C79918DD077F2EF78F37E24FEB110|ftsZ] on the mother cell side of the invaginating sporulation septa

locus
BSU_00640
Molecular weight
91.78 kDa
pI
6.14
Protein length
Gene length
function
control of [protein|search|SigF ]activity, required for normal formation of the asymmetric septum
product
protein serine phosphatase, septum-associated PP2C
essential
no
ec
3.1.3.16
synonyms
spoIIE, spoIIH, spoIIK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5817

This gene is a member of the following regulons

Gene
Coordinates
70,538  73,021
Phenotypes of a mutant
delay of the formation of polar [protein|search|FtsZ ]rings during [wiki|sporulation] [pubmed|28358838]
The protein
Catalyzed reaction/ biological activity
dephosphorylation of [protein|3936E91C062074BFE4284B54A8CC33F35F94F5EE|spoIIAA] (according to UniProt)
stabilization of [protein|search|ftsZ ]oligomers [pubmed|28358838]
required for the localization of [protein|672EA84D7725BE21F649DF30A11EB4E0EDFC3925|ftsA]-[protein|41872E2EF00C79918DD077F2EF78F37E24FEB110|ftsZ] on the mother cell side of the invaginating sporulation septa [pubmed|34018921]
Protein family
[wiki|PP2C phosphatase]
[wiki|Domains]
N-terminal trans-membrane domain [pubmed|28358838]
central oligomerization and FtsZ interaction domain [pubmed|28358838]
C-terminal PP2C phosphatase domain [pubmed|28358838]
[wiki|PPM-type phosphatase domain] (aa 594-804) (according to UniProt)
[wiki|Cofactors]
Mn 2+ [pubmed|28358838]
Structure
[PDB|5UCG] [pubmed|28527238]
[PDB|3T91] (phosphatase domain) [Pubmed|22115775]
[AF|P37475]
Effectors of protein activity
degraded by [protein|4E7B9426CED372AA8A321A147116A3A589FBF20C|ftsH], oligomerization and polar localization protect SpoIIE from degradation [Pubmed|26465112]
[wiki|Localization]
cell membrane [pubmed|28358838]
localizes to the polar cell division sites where it causes [protein|41872E2EF00C79918DD077F2EF78F37E24FEB110|ftsZ] to relocate from mid-cell to form polar Z-rings
forespore  [Pubmed|26465112]
localizes to the cell poles (via [protein|A8C0C2B7BCA6FFFF3811402D683FB7B99F7120A4|divIVA]) [Pubmed|26465112]
proper localization and stability depend on [protein|3282D2C25468776881778006F182FCF322C4821D|spoIIQ] [Pubmed|26929302]
Expression and Regulation
Operons
genes
[gene|7C8DFE00A2B2B30CC8BEB35055D92CC2E4128F3A|spoIIE]
description
(DBTBS) null
regulation
expressed under conditions that trigger sporulation ([wiki|Spo0A]) [http://www.ncbi.nlm.nih.gov/sites/entrez/1556084,15687200 PubMed]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: activation, [PubMed|1556084,15687200], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1556084], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|7C8DFE00A2B2B30CC8BEB35055D92CC2E4128F3A|spoIIE]

2022-11-21 22:36:16

ghost

21

83eff014f20e329e8ab20d546c1d1fed8b41ed3a

2F87975B32F8872567520DAC684A083BD5AF3143

genes
[gene|7C8DFE00A2B2B30CC8BEB35055D92CC2E4128F3A|spoIIE]-[gene|C8AA53889FC8B389E1D921B762BD78990C7A8E57|yabS]-[gene|E86A96B832351FF513DD9853EAD8998CC44C9951|yabT]-[gene|473F93EA5ADB78CD23C9C054B5D6B739078DDEEB|tilS]-[gene|B7BFC170EEC88DEC6CF932F80805D3F2C0BD3738|hprT]-[gene|4E7B9426CED372AA8A321A147116A3A589FBF20C|ftsH]
description
[pubmed|22383849]
regulation
expressed early during sporulation in the forespore ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]) [Pubmed|16497325]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|16497325], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
Open in new tab

[gene|7C8DFE00A2B2B30CC8BEB35055D92CC2E4128F3A|spoIIE]->[gene|4E7B9426CED372AA8A321A147116A3A589FBF20C|ftsH]

2022-11-25 17:00:23

Jstuelk

41

7069328a463a18ae1e3c27f03ddf76f79efe7c06

8FBB4B976CF46DAD9437300BBE1B22B618D33ED0

Biological materials
Mutant
MGNA-A083 (spoIIE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/83 NBRP B. subtilis, Japan]
BKE00640 ([gene|7C8DFE00A2B2B30CC8BEB35055D92CC2E4128F3A|spoIIE]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE00640 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCCTCTCATCTCCCACC,  downstream forward: _UP4_TAACGCTTCCGTATAAATCA
BKK00640 ([gene|7C8DFE00A2B2B30CC8BEB35055D92CC2E4128F3A|spoIIE]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK00640 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCCTCTCATCTCCCACC,  downstream forward: _UP4_TAACGCTTCCGTATAAATCA
labs
[wiki|Imrich Barak], Slovak Academy of Science, Bratislava, Slovakia [http://imb.savba.sk/~barak/ homepage]
References
Reviews
28500523,30855188,31350897,35638784
Original Publications
27415800,7570023,7570022,12180929,9077448,9364910,10323866,8622920,12007411,16824103,10476035,10747015,10322028,15978076,9495766,14744853,9642177,15866939,8846916,1556084,1948031,9573053,18077456,11846550,9150232,15205443,1556084,15687200,19578359,10049355,20817757,22115775,25101664,11846550,26465112,26929302,28358838,28527238,30092000,32630428,33684446,34018921

7C8DFE00A2B2B30CC8BEB35055D92CC2E4128F3A

Page visits: 4896

Time of last update: 2022-12-05 08:58:06

Author of last update: Jstuelk