SubtiWiki SubtiWiki
ymcB

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ymcB
168

tRNA methylthiotransferase

locus
BSU_17010
Molecular weight
58.00 kDa
pI
6.87
Protein length
Gene length
function
tRNA maturation
product
tRNA methylthiotransferase
essential
no
synonyms
miaB, ymcB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0621

This gene is a member of the following regulons

Gene
Coordinates
1,772,843  1,774,372
The protein
Catalyzed reaction/ biological activity
modifies N(6)-isopentenyladenosine (i(6)A) to 2-methylthio-N(6)-isopentenyladenosine (ms(2)i(6)A) in tRNA [Pubmed|20472640]
[sulfur carrier]-SH + AH2 + N6-dimethylallyladenosine37 in tRNA + 2 S-adenosyl-L-methionine --> 2-methylsulfanyl-N6-dimethylallyladenosine37 in tRNA + 5'-deoxyadenosine + [sulfur carrier]-H + A + 2 H+ + L-methionine + S-adenosyl-L-homocysteine (according to UniProt)
Protein family
methylthiotransferase family (with [protein|6ADA5AF308D96218414EA92DFF4A57BAEAD0554B|yqeV], according to UniProt)
[wiki|Domains]
MTTase N-terminal domain (aa 66-184) (according to UniProt)
[wiki|TRAM domain] (aa 440-503) (according to UniProt)
[wiki|Cofactors]
Fe-S cluster [pubmed|29292548]
Structure
[PDB|4JC0] (from Thermotoga maritima, 33% for aa 70 ... 504) [pubmed|23542644]
Paralogous protein(s)
[protein|6ADA5AF308D96218414EA92DFF4A57BAEAD0554B|yqeV]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|7C9F99FF1BCDB0E1CFB0AFE959C7F16A99562E18|ymcB]-[gene|EE52DFA35B935E551871D079A9BE877DB2001A3B|ymcA]
description
[Pubmed|22383849]
Open in new tab

[gene|7C9F99FF1BCDB0E1CFB0AFE959C7F16A99562E18|ymcB]→[gene|EE52DFA35B935E551871D079A9BE877DB2001A3B|ymcA]

2021-11-19 13:40:54

Jstuelk

3

3e3a6f134a159c836765f56a2b8ca1ad0486f543

499370F86D29FCA5A0F1CC6BF69F2E56ADD25D11

Biological materials
Mutant
GP1109 (spc), available in [wiki|Jörg Stülke]'s lab
BKE17010 ([gene|7C9F99FF1BCDB0E1CFB0AFE959C7F16A99562E18|ymcB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17010 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCATATTTTCTCCTTT,  downstream forward: _UP4_GGAGAAGCAATCGAGGTGAA
BKK17010 ([gene|7C9F99FF1BCDB0E1CFB0AFE959C7F16A99562E18|ymcB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17010 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCATATTTTCTCCTTT,  downstream forward: _UP4_GGAGAAGCAATCGAGGTGAA
References
20472640,23542644

7C9F99FF1BCDB0E1CFB0AFE959C7F16A99562E18

Page visits: 1330

Time of last update: 2022-01-18 20:42:52

Author of last update: Melvin.boenninger