yfkQ

yfkQ
168

part of the [protein|7CE0CAF27B1C0F507E783B8B80622270B00634FD|yfkQ]-[protein|B7EEC1910715507596734540D24B3C93B4B7065F|yfkR]-[protein|7A62875A659B9F0967C392F38895D9E15A29D559|yfkT] germinant receptor of unknown specificity

locus
BSU_07790
Molecular weight
57.54 kDa
pI
6.23
Protein length
Gene length
function
germination
product
part of the [protein|7CE0CAF27B1C0F507E783B8B80622270B00634FD|yfkQ]-[protein|B7EEC1910715507596734540D24B3C93B4B7065F|yfkR]-[protein|7A62875A659B9F0967C392F38895D9E15A29D559|yfkT] germinant receptor
essential
no
synonyms
yfkQ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5901

This gene is a member of the following regulons

Gene
Coordinates
848,633  850,174
The protein
Protein family
[wiki|GerABKA family] (according to UniProt)
Structure
[PDB|6O59] (from B. megaterium, corresponds to aa 31 ... 281, 44.1% identity) [pubmed|31113879]
[AF|O34486]
Paralogous protein(s)
[protein|AE28299B0F274B189DD90554A5A4F7B9A9479B60|yndD], [protein|EDB2F4C132211F01654F2A2ED3D220EC15CE6F22|gerKA], [protein|EEDE6A22E91992ABCA677CAB7917B7168C5CB868|gerAA], [protein|3368743E6E03792DB83A38A19989123304DF7560|gerBA]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|7CE0CAF27B1C0F507E783B8B80622270B00634FD|yfkQ]-[gene|B7EEC1910715507596734540D24B3C93B4B7065F|yfkR]-[gene|AA76BEF6A4CECB5D3910918E8D91D8B919EDEA7E|yfkS]-[gene|7A62875A659B9F0967C392F38895D9E15A29D559|yfkT]
description
[Pubmed|22383849]
regulation
expressed during [wiki|sporulation] in the forespore [Pubmed|15699190]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|7CE0CAF27B1C0F507E783B8B80622270B00634FD|yfkQ]→[gene|7A62875A659B9F0967C392F38895D9E15A29D559|yfkT]

2023-01-03 13:21:53

ghost

43

dda636dad622bad6868e738ae38525bc698bc72c

666F97F8C688D10436B55A68B5DECBC89AB10ED5

Biological materials
Mutant
MGNA-C345 (yfkQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2343 NBRP B. subtilis, Japan]
BKE07790 ([gene|7CE0CAF27B1C0F507E783B8B80622270B00634FD|yfkQ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE07790 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGAGGCTCACCCTGCTT,  downstream forward: _UP4_GGAGCGAAAAGAGAGGACCC
BKK07790 ([gene|7CE0CAF27B1C0F507E783B8B80622270B00634FD|yfkQ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK07790 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGAGGCTCACCCTGCTT,  downstream forward: _UP4_GGAGCGAAAAGAGAGGACCC
References
15699190,22383849,10762253,31113879

7CE0CAF27B1C0F507E783B8B80622270B00634FD

Page visits: 2043

Time of last update: 2023-02-06 17:54:17

Author of last update: Jstuelk