ywtG

ywtG
168

general stress protein, similar to glucose transporter

locus
BSU_35830
Molecular weight
49.03 kDa
pI
9.57
Protein length
Gene length
function
unknown
product
putative glucose transporter
essential
no
synonyms
ywtG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2814

This gene is a member of the following regulons

Gene
Coordinates
3,692,533  3,693,906
The protein
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
[wiki|Sugar transporter (TC 2.A.1.1) family] (according to UniProt)
Structure
[PDB|4LDS] (from Staphylococcus epidermidis, 52% identity) [pubmed|24127585]
[AF|C0SPB2]
Paralogous protein(s)
[protein|8B0701B5694ABA8142476CB896E590FE1981D7DB|yfiG], [protein|A84AC4E40E7C722E27AE9C24ACECFEABD51B57BE|yncC], [protein|0757FAEB38AA1C599C5067794AF83A4BA5912DC9|csbC], [protein|4A77316AA94F9C11DB70AB76711AACBD28098AA1|iolT], [protein|770D9A5BEEEABE9C3FC772E74001329206ECFAB3|araE]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|7CE5A42042E5D52768735E795DB805530691D8A6|ywtG]
description
[pubmed|22383849]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|7CE5A42042E5D52768735E795DB805530691D8A6|ywtG]

2022-11-28 06:20:29

Bzhu

23

54cc5063b14a21e1e7f9cd6bfbd33bc8b2f70c89

3AEF54988BABAA1137482BF10A7F1E9FFAD84B57

Biological materials
Mutant
MGNA-A548 (ywtG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/548 NBRP B. subtilis, Japan]
BKE35830 ([gene|7CE5A42042E5D52768735E795DB805530691D8A6|ywtG]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE35830 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAAGATGACTCCCTTTC,  downstream forward: _UP4_TAAAAAAGGGTGCGCGATCA
BKK35830 ([gene|7CE5A42042E5D52768735E795DB805530691D8A6|ywtG]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK35830 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAAGATGACTCCCTTTC,  downstream forward: _UP4_TAAAAAAGGGTGCGCGATCA
References
15805528,24127585

7CE5A42042E5D52768735E795DB805530691D8A6

Page visits: 1391

Time of last update: 2022-12-09 08:04:11

Author of last update: Melvin.boenninger