SubtiWiki SubtiWiki
yhjO

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yhjO
168

similar to multidrug-efflux transporter

locus
BSU_10580
Molecular weight
43.90 kDa
pI
9.69
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yhjO

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,132,179  1,133,384
The protein
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
[wiki|Localization]
cell membrane (according to UniProt)
Biological materials
Mutant
MGNA-B287 (yhjO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1286 NBRP B. subtilis, Japan]
BKE10580 ([gene|7CF92AB56695063A3061E1380929A76E675243F7|yhjO]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10580 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTGATCGCCGCCTTTCG,  downstream forward: _UP4_TAGAAAATAATTCATAATTT
BKK10580 ([gene|7CF92AB56695063A3061E1380929A76E675243F7|yhjO]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10580 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTGATCGCCGCCTTTCG,  downstream forward: _UP4_TAGAAAATAATTCATAATTT

7CF92AB56695063A3061E1380929A76E675243F7

Page visits: 1127

Time of last update: 2022-01-24 01:26:44

Author of last update: Melvin.boenninger