pbuX

pbuX
168

xanthine transport in/out via proton symport

locus
BSU_22060
Molecular weight
46.08 kDa
pI
8.79
Protein length
Gene length
function
xanthine uptake
product
xanthine permease
essential
no
synonyms
pbuX, ypaQ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2233

This gene is a member of the following regulons

Gene
Coordinates
2,318,127  2,319,443
The protein
Protein family
[wiki|xanthine/uracil permease family] (according to UniProt)
[wiki|Nucleobase:cation symporter-2 (NCS2) (TC 2.A.40) subfamily] (according to UniProt)
Structure
[PDB|5I6C] (Aspergillus nidulans purine transporter, 27% identity) [pubmed|27088252]
[AF|P42086]
Paralogous protein(s)
[protein|3162EF36F4441A1E4EBBFDAD19F6768D8EF21B29|pucK], [protein|53950BFDC128DE46F3F43BDB9D0FDB3D645152DF|pucJ]
[wiki|Localization]
membrane [Pubmed|18763711]
Expression and Regulation
Operons
genes
[gene|02C84C9A8C0008CC253CBF13584A4B5B2D2B510C|xpt]-[gene|7D56F85FBD3AAC66607DD7465592EEAE09D61C98|pbuX]
description
[Pubmed|9098051]
regulation
induced in the absence of guanine ([wiki|G-box]) [Pubmed|12787499]
regulatory mechanism
G-box: termination, [wiki|riboswitch] [Pubmed|9098051,12787499], in [regulon|other_regulator:G-box|G-box]
[protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|purR]: repression, (molecular inducer: PRPP) [Pubmed|11591660], in [regulon|protein:A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|purR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9098051], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|02C84C9A8C0008CC253CBF13584A4B5B2D2B510C|xpt]→[gene|7D56F85FBD3AAC66607DD7465592EEAE09D61C98|pbuX]

2022-09-20 12:30:54

Jstuelk

22

e2aea9be4482d2f1a4ec3d17e057d345c5db5dbf

D9AD2007FF8AC8985A79EBB6FAAF4F457CB0852B

Biological materials
Mutant
BKE22060 ([gene|7D56F85FBD3AAC66607DD7465592EEAE09D61C98|pbuX]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE22060 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAGCGTTTTGCCGAATCCAT,  downstream forward: _UP4_AAAACAGCAGTCTAACTCCG
BKK22060 ([gene|7D56F85FBD3AAC66607DD7465592EEAE09D61C98|pbuX]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK22060 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAGCGTTTTGCCGAATCCAT,  downstream forward: _UP4_AAAACAGCAGTCTAACTCCG
References
12923093,11591660,9098051,11591660,18763711,27088252

7D56F85FBD3AAC66607DD7465592EEAE09D61C98

Page visits: 2238

Time of last update: 2022-10-03 21:53:07

Author of last update: Melvin.boenninger