nagP

nagP
168

N-acetylglucosamine-specific [wiki|phosphotransferase system], EIICB of the [category|SW.1.2.2|PTS]

locus
BSU_07700
Molecular weight
48.42 kDa
pI
7.13
Protein length
Gene length
function
N-acetylglucosamine uptake and phosphorylation
product
N-acetylglucosamine-specific [category|SW.1.2.2|PTS], EIICB
essential
no
ec
2.7.1.69
synonyms
nagP, yflF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1264

This gene is a member of the following regulons

Gene
Coordinates
840,656  842,014
Phenotypes of a mutant
no growth on N-acetylglucosamine [Pubmed|23667565]
The protein
Protein family
[category|SW.1.2.2|PTS] permease, glucose family [Pubmed|10627040]
[wiki|Domains]
[wiki|PTS EIIB domain] type-1 (aa 375-452) (according to UniProt)
[wiki|PTS EIIC domain] type-1 (aa 1-361) (according to UniProt)
Structure
[PDB|6BVG] (from B. cereus, the EIIC domain, corresponds to aa 3 ... 362 of NagP, 28% identity) [pubmed|29784777]
[AF|O34521]
Paralogous protein(s)
[protein|4DF1740D4DFB9FD25E77C14D28AEA01707776099|gamP]
[wiki|Localization]
cell membrane [Pubmed|18763711]
Expression and Regulation
Operons
genes
[gene|7D5A8084FDDA962CCF028FC3735E68C4F2E77084|nagP]
description
[Pubmed|23667565]
regulation
induced in the presence of N-acetylglucosamine ([protein|search|NagR]) [Pubmed|21602348]
regulatory mechanism
[protein|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|nagR]: repression, [Pubmed|21602348], in [regulon|protein:6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|nagR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|23667565], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|7D5A8084FDDA962CCF028FC3735E68C4F2E77084|nagP]

2022-11-17 03:49:26

ghost

20

56fd90c040a4a103624d580feab874158ce9a7fd

B35D6EE5163B9D20DFD5E08028D4E2121CAF2D06

Biological materials
Mutant
MGNA-C339 (yflF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2337 NBRP B. subtilis, Japan]
BKE07700 ([gene|7D5A8084FDDA962CCF028FC3735E68C4F2E77084|nagP]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE07700 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACCCATCCCCCTCATAC,  downstream forward: _UP4_TAAAAAAGCGGAGAGGGCAA
BKK07700 ([gene|7D5A8084FDDA962CCF028FC3735E68C4F2E77084|nagP]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK07700 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACCCATCCCCCTCATAC,  downstream forward: _UP4_TAAAAAAGCGGAGAGGGCAA
References
Reviews
26159076
Original Publications
10627040,18763711,10627040,6174502,23667565,21602348,23876412,30038046,29784777

7D5A8084FDDA962CCF028FC3735E68C4F2E77084

Page visits: 1973

Time of last update: 2022-11-25 10:54:26

Author of last update: Melvin.boenninger