nagP
168
N-acetylglucosamine-specific [wiki|phosphotransferase system], EIICB of the [category|SW.1.2.2|PTS]
locus
BSU_07700
Molecular weight
48.42 kDa
pI
7.13
function
N-acetylglucosamine uptake and phosphorylation
product
N-acetylglucosamine-specific [category|SW.1.2.2|PTS], EIICB
essential
no
ec
2.7.1.69
synonyms
nagP, yflF
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG1264 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
840,656 842,014
Phenotypes of a mutant
no growth on N-acetylglucosamine [Pubmed|23667565]
The protein
Protein family
[category|SW.1.2.2|PTS] permease, glucose family [Pubmed|10627040]
[wiki|Domains]
[wiki|PTS EIIB domain] type-1 (aa 375-452) (according to UniProt)
[wiki|PTS EIIC domain] type-1 (aa 1-361) (according to UniProt)
Structure
[PDB|6BVG] (from B. cereus, the EIIC domain, corresponds to aa 3 ... 362 of NagP, 28% identity) [pubmed|29784777]
[AF|O34521]
Paralogous protein(s)
[protein|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG], [protein|E6C7733A12AF9A5322EED444E4A4FF1605A8B20F|malP], [protein|4DF1740D4DFB9FD25E77C14D28AEA01707776099|gamP]
[wiki|Localization]
cell membrane [Pubmed|18763711]
Expression and Regulation
Operons
genes
[gene|7D5A8084FDDA962CCF028FC3735E68C4F2E77084|nagP]
description
[Pubmed|23667565]
regulation
induced in the presence of N-acetylglucosamine ([protein|search|NagR]) [Pubmed|21602348]
regulatory mechanism
[protein|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|nagR]: repression, [Pubmed|21602348], in [regulon|protein:6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|nagR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|23667565], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Biological materials
Mutant
MGNA-C339 (yflF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2337 NBRP B. subtilis, Japan]
BKE07700 ([gene|7D5A8084FDDA962CCF028FC3735E68C4F2E77084|nagP]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE07700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCCATCCCCCTCATAC, downstream forward: _UP4_TAAAAAAGCGGAGAGGGCAA
BKK07700 ([gene|7D5A8084FDDA962CCF028FC3735E68C4F2E77084|nagP]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK07700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCCATCCCCCTCATAC, downstream forward: _UP4_TAAAAAAGCGGAGAGGGCAA
References
Reviews
Original Publications
Page visits: 4509
Time of last update: 2025-10-26 17:09:11
Author of last update: Melvin.boenninger