yraG

yraG
168

forespore-specific sporulation protein,similar to spore coat protein

locus
BSU_26950
Molecular weight
9.07 kDa
pI
4.75
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yraG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5896

This gene is a member of the following regulons

Gene
Coordinates
2,752,802  2,753,047
The protein
Protein family
[wiki|CotF family] (according to UniProt)
Structure
[AF|O07919]
Expression and Regulation
Operons
genes
[gene|7D61DB3A298C253BBC1C7B3AE169F8AAAE4610BB|yraG]-[gene|30A4306899B586898BC5B3666AD43D9DEE0579E1|yraF]-[gene|EA4CC0D36C39957DBBF9B1B11F65F33E8CD81FFE|adhB]-[gene|1D9D20DA24C13EF450710E8EDC5A36311DAF1BF0|yraE]-[gene|0D99D9ECB3BCD6E3F58F8CE8E8CC5AF718C1ECD8|yraD]
description
[Pubmed|16497325]
regulation
expressed during sporulation in the forespore ([protein|search|SigG]) [Pubmed|16497325]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|16497325], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|7D61DB3A298C253BBC1C7B3AE169F8AAAE4610BB|yraG]→[gene|0D99D9ECB3BCD6E3F58F8CE8E8CC5AF718C1ECD8|yraD]

2023-02-05 08:41:10

ghost

47

d7b65b29af87b17d60d957745dbcb60005e27aaf

1230FD48E94D5C4C5D5DC8D83656D0C540213821

Biological materials
Mutant
BKE26950 ([gene|7D61DB3A298C253BBC1C7B3AE169F8AAAE4610BB|yraG]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE26950 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTGATGTAACCTCCTT,  downstream forward: _UP4_AATTGAAAGGGAGGTAAGCC
BKK26950 ([gene|7D61DB3A298C253BBC1C7B3AE169F8AAAE4610BB|yraG]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK26950 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTGATGTAACCTCCTT,  downstream forward: _UP4_AATTGAAAGGGAGGTAAGCC
References
16497325

7D61DB3A298C253BBC1C7B3AE169F8AAAE4610BB

Page visits: 1189

Time of last update: 2023-02-05 16:55:00

Author of last update: Melvin.boenninger