SubtiWiki SubtiWiki
acdA
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

acdA
168

acyl-CoA dehydrogenase

locus
BSU_37170
Molecular weight
41.29 kDa
pI
4.95
Protein length
Gene length
function
fatty acid degradation
product
acyl-CoA dehydrogenase
essential
no
synonyms
acdA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1960

This gene is a member of the following regulons

Gene
Coordinates
3,813,246  3,814,385
The protein
Catalyzed reaction/ biological activity
A + 2,3-saturated acyl-CoA --> 2,3-dehydroacyl-CoA + AH2 (according to UniProt)
Protein family
[wiki|Acyl-CoA dehydrogenase family] (according to UniProt)
[wiki|Cofactors]
FAD (according to UniProt)
Structure
[PDB|2Z1Q] (from ''Thermus thermophilus hb8'', 40% identity, 55% similarity)
Paralogous protein(s)
[protein|B5325CBF1408E2CA227EB462092E209F4C87E797|fadE], [protein|BA28DFBAF88A4994B0541D1FF2187312FDE1FA15|yngJ], [protein|F25CDDEBAFC72036664323619F5197D45E86BE9A|mmgC]
Expression and Regulation
Operons
genes
[gene|DEE0DA15EE9EA27BA8C332204E40D336324A111C|fadF]-[gene|7D89BBB52403BF99416250688EFA90C2BE8EB591|acdA]-[gene|632C661255DD9C2865CB2F9D68A805997A833BCB|rpoE]
description
[Pubmed|17189250]
regulation
repressed in the absence of long-chain fatty acids ([protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|fadR]) [Pubmed|17189250]
regulatory mechanism
[protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|fadR]: repression, [Pubmed|17189250], in [regulon|protein:8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|fadR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|17189250], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|DEE0DA15EE9EA27BA8C332204E40D336324A111C|fadF]→[gene|632C661255DD9C2865CB2F9D68A805997A833BCB|rpoE]

2021-08-23 22:37:56

Jstuelk

8

404be419ef45bd05929352ef6ba5dc0e434ec1c3

9C9A5D2281D0C2A74A807FF5D3F4169BC992CAFF

Biological materials
Mutant
BKE37170 ([gene|7D89BBB52403BF99416250688EFA90C2BE8EB591|acdA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37170 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATTCATTGCTTCTCCCCCAT,  downstream forward: _UP4_TAACGGAAAACATCTCTCAG
BKK37170 ([gene|7D89BBB52403BF99416250688EFA90C2BE8EB591|acdA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37170 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATTCATTGCTTCTCCCCCAT,  downstream forward: _UP4_TAACGGAAAACATCTCTCAG
References
17189250,17919287

7D89BBB52403BF99416250688EFA90C2BE8EB591

Page visits: 1304

Time of last update: 2021-09-22 12:39:10

Author of last update: Melvin.boenninger