bpsA

bpsA
168

type III polyketide synthase

locus
BSU_22050
Molecular weight
40.55 kDa
pI
7.96
Protein length
Gene length
function
polyketide synthesis
product
type III polyketide synthase
essential
no
ec
2.3.1.74
synonyms
bpsA, bcsA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3424

This gene is a member of the following regulons

Gene
Coordinates
2,316,956  2,318,053
The protein
Catalyzed reaction/ biological activity
synthesis of triketide pyrones from long-chain fatty acyl CoA thioesters as starter substrates and malonyl-CoA as an extender substrate [Pubmed|19465653]
4-coumaroyl-CoA + 2 H+ + 3 malonyl-CoA --> 2',4,4',6'-tetrahydroxychalcone + 3 CO2 + 4 CoA (according to UniProt)
Protein family
[wiki|thiolase-like superfamily] (according to UniProt)
Structure
[PDB|4JAO] (from Mycobacterium tuberculosis, 34% identity) [pubmed|23615910]
[AF|P54157]
Expression and Regulation
Operons
genes
[gene|7D90F7AF49BAD6A95731BF805991DEBBBCAFA46C|bpsA]-[gene|6BAF5763249305F27326F941A34956396B3F8C99|bpsB]
description
[Pubmed|19465653]
Open in new tab

[gene|7D90F7AF49BAD6A95731BF805991DEBBBCAFA46C|bpsA]→[gene|6BAF5763249305F27326F941A34956396B3F8C99|bpsB]

2022-08-21 02:48:46

ghost

13

8889bdbb47d5cd3070f477acb378e4900fe1a36a

9E921FCD7E68BD3C0070A5633C1B3121483061F8

Biological materials
Mutant
MGNA-A875 (bcsA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/875 NBRP B. subtilis, Japan]
BKE22050 (''[gene|7D90F7AF49BAD6A95731BF805991DEBBBCAFA46C|bpsA]''::''erm'', available in the BGSC and in [wiki|Jörg Stülke]'s lab) [pubmed|28189581]
GP1820 (''[gene|7D90F7AF49BAD6A95731BF805991DEBBBCAFA46C|bpsA]''::''erm'', available in [wiki|Jörg Stülke]'s lab)
BKE22050 ([gene|7D90F7AF49BAD6A95731BF805991DEBBBCAFA46C|bpsA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE22050 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCGATCACCTCTTTGCA,  downstream forward: _UP4_AGCTGGGAAAAGGGGGCCTG
BKK22050 ([gene|7D90F7AF49BAD6A95731BF805991DEBBBCAFA46C|bpsA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK22050 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCGATCACCTCTTTGCA,  downstream forward: _UP4_AGCTGGGAAAAGGGGGCCTG
References
19465653,23615910

7D90F7AF49BAD6A95731BF805991DEBBBCAFA46C

Page visits: 1696

Time of last update: 2022-10-03 16:13:10

Author of last update: Melvin.boenninger