ybaF

ybaF
168

trans-membrane T component of [wiki|ECF transporter]s

locus
BSU_01470
Molecular weight
29.54 kDa
pI
10.18
Protein length
Gene length
function
uptake of micronutrients
product
[wiki|ECF transporter] (membrane-spanning protein)
essential
no
synonyms
ybaF, ecfT

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0619

This gene is a member of the following regulons

Gene
Coordinates
152,130  152,927
Phenotypes of a mutant
defective in swarming motility (reduced rate of colony expansion) [pubmed|35638827]
The protein
Protein family
energy-coupling factor EcfT family (single member, according to UniProt)
Structure
[PDB|4HUQ] (EcfA1-EcfA2-EcfT-FolT complex of ''Lactobacillus brevis''), [Pubmed|23584589]
[AF|P70972]
[wiki|Localization]
cell membrane [Pubmed|20497229]
Biological materials
Mutant
MGNA-B945 (ybaF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1944 NBRP B. subtilis, Japan]
BKE01470 ([gene|7DC7BD54ED425859FFD45B8B6F3522750A938835|ybaF]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE01470 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTTGCCGATAATCATGCTGT,  downstream forward: _UP4_TTCTTAAGGGCTTAGAGGTG
BKK01470 ([gene|7DC7BD54ED425859FFD45B8B6F3522750A938835|ybaF]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK01470 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTTGCCGATAATCATGCTGT,  downstream forward: _UP4_TTCTTAAGGGCTTAGAGGTG
BP1149 ([gene|D8637043C7E2291589C966E95F94DC61B1A8AB75|ybxA]-[gene|5ABF4F7A3D00B523F67B281241A6A8101EC60057|ybaE]-[gene|7DC7BD54ED425859FFD45B8B6F3522750A938835|ybaF]::cat trp+) available at [wiki|Jörg Stülke]'s and [wiki|Fabian Commichau]'s labs
References
10092453,20497229,22574898,24362466,35638827

7DC7BD54ED425859FFD45B8B6F3522750A938835

Page visits: 2573

Time of last update: 2022-12-06 11:53:20

Author of last update: Jstuelk