mtrA

mtrA
168

methylthioribose transporter

locus
BSU_07340
Molecular weight
48.74 kDa
pI
9.82
Protein length
Gene length
function
uptake of methylthioribose
product
methylthioribose transporter
essential
no
synonyms
mtrA, yfnA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0531

This gene is a member of the following regulons

Gene
Coordinates
805,456  806,841
The protein
Catalyzed reaction/ biological activity
uptake of methylthioribose [pubmed|29280348]
Protein family
[wiki|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
Structure
[PDB|5OQT] (from Geobacillus kaustophilus, 60% identity) [pubmed|29416041]
[AF|Q797A7]
Paralogous protein(s)
[protein|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP]
[wiki|Localization]
cell membrane [Pubmed|18763711]
Expression and Regulation
Operons
genes
[gene|7E180420EB053D9EF7993EF600A169C446F905F9|mtrA]-[gene|2E1E22349750C3EE9B6575EED30A82ED0D5F07F0|yfnB]
description
[Pubmed|22383849]
Open in new tab

[gene|7E180420EB053D9EF7993EF600A169C446F905F9|mtrA]→[gene|2E1E22349750C3EE9B6575EED30A82ED0D5F07F0|yfnB]

2022-11-17 22:56:21

Jstuelk

14

b6b78bb6887a7ceaf2f3c3e8eeafcaa8ecfb4296

3386852116AAF37D19BAA57D64A70CDF2C264211

genes
[gene|7E180420EB053D9EF7993EF600A169C446F905F9|mtrA]
description
[pubmed|22383849]
Open in new tab

[gene|7E180420EB053D9EF7993EF600A169C446F905F9|mtrA]

2022-11-29 05:19:05

Jstuelk

12

8e0618377faa3c5ab34cc9ec988fa2714687299e

4CBCCD9936294E55FE1FD1CF5FDBFB3A6C7E1A3B

Biological materials
Mutant
GP2379 ∆''[gene|7E180420EB053D9EF7993EF600A169C446F905F9|mtrA]''::''kan'', available in [wiki|Jörg Stülke]'s lab [pubmed|32743959]
MGNA-C231 (yfnA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2229 NBRP B. subtilis, Japan]
BKE07340 ([gene|7E180420EB053D9EF7993EF600A169C446F905F9|mtrA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE07340 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCAAAAGTTCCTCCTAGA,  downstream forward: _UP4_TAATCTCTTTTCAGCCGGCG
BKK07340 ([gene|7E180420EB053D9EF7993EF600A169C446F905F9|mtrA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK07340 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCAAAAGTTCCTCCTAGA,  downstream forward: _UP4_TAATCTCTTTTCAGCCGGCG
lacZ fusion
pGP2278 (in [wiki|pAC5]) (GP2964), available in [wiki|Jörg Stülke]'s lab
References
18763711,29280348,29416041

7E180420EB053D9EF7993EF600A169C446F905F9

Page visits: 1377

Time of last update: 2022-11-28 04:15:05

Author of last update: Jstuelk