SubtiWiki SubtiWiki
ywbF

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ywbF
168

unknown

locus
BSU_38340
Molecular weight
43.85 kDa
pI
9.7
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ywbF, ipa-21r

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2814

This gene is a member of the following regulons

Gene
Coordinates
3,934,358  3,935,557
The protein
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
Structure
[PDB|2V8N] (E. coli lactose permease, corresponds to aa 25 ... 283, 22% identity) [pubmed|17881559]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|7EBA1CC70E1E8A73D0E7B3969522633EC42C1C2E|ywbF]-[gene|A63DF11087CEA2D8F5852E6540EFDF0EBCAB96B1|ywbE]
description
[pubmed|22383849]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
Open in new tab

[gene|7EBA1CC70E1E8A73D0E7B3969522633EC42C1C2E|ywbF]->[gene|A63DF11087CEA2D8F5852E6540EFDF0EBCAB96B1|ywbE]

2021-07-23 19:39:25

Bzhu

2

bb9f64566a6f0ba37f170f020758cf811c6590ae

3A360A1F657FD8C41250946A2148E72B714823FD

Biological materials
Mutant
MGNA-B223 (ywbF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1222 NBRP B. subtilis, Japan]
BKE38340 ([gene|7EBA1CC70E1E8A73D0E7B3969522633EC42C1C2E|ywbF]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38340 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCAGGGTGCCTCCTTTGG,  downstream forward: _UP4_TAATGACTATAATGAACAAA
BKK38340 ([gene|7EBA1CC70E1E8A73D0E7B3969522633EC42C1C2E|ywbF]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38340 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCAGGGTGCCTCCTTTGG,  downstream forward: _UP4_TAATGACTATAATGAACAAA
References
220817675,17881559

7EBA1CC70E1E8A73D0E7B3969522633EC42C1C2E

Page visits: 894

Time of last update: 2022-01-11 23:57:44

Author of last update: Melvin.boenninger