citS

citS
168

two-component sensor kinase, regulation of citrate uptake

locus
BSU_07580
Molecular weight
59.72 kDa
pI
6.48
Protein length
Gene length
function
regulation of citrate uptake
product
two-component sensor kinase
essential
no
synonyms
citS, yflR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3290

This gene is a member of the following regulons

Gene
Coordinates
830,945  832,573
Phenotypes of a mutant
no growth with citrate as sole carbon source [Pubmed|10972810]
The protein
Catalyzed reaction/ biological activity
autophosphorylation, phosphorylation of [protein|1345FBA88CB55E0E897FEC8DA4D829B85A8393BB|citT]
ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)
[wiki|Domains]
two transmembrane segments
[wiki|PAS domain]
[wiki|Histidine kinase domain] (aa 336-528) (according to UniProt)
Structure
[AF|O34427]
Modification
autophosphorylation on a His residue
Effectors of protein activity
activity may be controlled by interaction with [protein|E4F1B49C26BCB4E3E596406A83CCDCC20AD4A3DB|yflP] [Pubmed|14499931]
[wiki|Localization]
cell membrane (Heterogeneous) [Pubmed|16479537]
Expression and Regulation
Operons
genes
[gene|7EBB09F8FF4C2FBE35B4689B15D89FEF3D58A227|citS]-[gene|1345FBA88CB55E0E897FEC8DA4D829B85A8393BB|citT]-[gene|E4F1B49C26BCB4E3E596406A83CCDCC20AD4A3DB|yflP]
description
[Pubmed|10972810]
Open in new tab

[gene|7EBB09F8FF4C2FBE35B4689B15D89FEF3D58A227|citS]→[gene|E4F1B49C26BCB4E3E596406A83CCDCC20AD4A3DB|yflP]

2022-11-27 17:29:05

ghost

22

48338d903fc735b45d81f8161ce84e9f939ab895

A343A4499D2510EF9EAD9C7890ADE3F0FA94FC7F

Biological materials
Mutant
MGNA-C333 (citS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2331 NBRP B. subtilis, Japan]
BKE07580 ([gene|7EBB09F8FF4C2FBE35B4689B15D89FEF3D58A227|citS]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE07580 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAGCACCAGCCGTCCTTT,  downstream forward: _UP4_AAGGAGAAACAAAGGGGGAA
BKK07580 ([gene|7EBB09F8FF4C2FBE35B4689B15D89FEF3D58A227|citS]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK07580 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAGCACCAGCCGTCCTTT,  downstream forward: _UP4_AAGGAGAAACAAAGGGGGAA
References
Reviews
28152228
Original Publications
10094672,16842348,10972810,16479537,14499931

7EBB09F8FF4C2FBE35B4689B15D89FEF3D58A227

Page visits: 1394

Time of last update: 2022-11-30 18:34:09

Author of last update: Melvin.boenninger