mscL

mscL
168

large conductance mechanosensitive channel protein, prevents selective release of cytoplasmic proteins in a hypotonic environment

locus
BSU_36360
Molecular weight
14.14 kDa
pI
4.65
Protein length
Gene length
function
resistance to osmotic downshock, glycine betaine export
product
large conductance mechanosensitive channel protein
essential
no
synonyms
mscL, ywpC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1970

This gene is a member of the following regulons

Gene
Coordinates
3,743,267  3,743,659
Phenotypes of a mutant
sensitive to osmotic downshock (> 0.5 M) during logarithmic growth [Pubmed|19252899]
The protein
Protein family
mscL family (single member, according to UniProt)
Structure
[PDB|3HZQ] (MscL of ''Staphylococcus aureus'') [Pubmed|19701184]
[AF|P94585]
[wiki|Localization]
cell membrane [Pubmed|19252899]
Expression and Regulation
Operons
genes
[gene|BDA23FA513C240B07DC109BB62A7A5EB96B20965|ywpB]-[gene|7F7BC285A1D02B031575BA7E980293CD2962C84A|mscL]
description
[Pubmed|22383849]
regulation
expressed in logarithmic phase [Pubmed|19252899]
Open in new tab

[gene|BDA23FA513C240B07DC109BB62A7A5EB96B20965|ywpB]→[gene|7F7BC285A1D02B031575BA7E980293CD2962C84A|mscL]

2022-11-14 23:33:53

Jstuelk

34

5415340d20ac4baa52c66698ec0cc9bee9f29809

9C0AC698BF01AA86D7382CE0D746D52B12FABB4F

Biological materials
Mutant
MGNA-A562 (ywpC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/562 NBRP B. subtilis, Japan]
1A957 ( ''mscL''::''spec''), [Pubmed|18310427], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A957&Search=1A957 BGSC]
BKE36360 ([gene|7F7BC285A1D02B031575BA7E980293CD2962C84A|mscL]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE36360 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACAATCACCTGCTTTTC,  downstream forward: _UP4_TAAAAAAGATGCCGTTAGAA
BKK36360 ([gene|7F7BC285A1D02B031575BA7E980293CD2962C84A|mscL]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK36360 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACAATCACCTGCTTTTC,  downstream forward: _UP4_TAAAAAAGATGCCGTTAGAA
References
Reviews
12626684,19727188,20825352,22685280,24258154,22685280,24607989,17505523,33244613
Original Publications
17665170,18310427,19160392,16897034,19252899,19701184,9632260,19738010,9353933
Labs working on this gene/protein
[wiki|Jan Maarten van Dijl], Groningen, Netherlands
[wiki|Erhard Bremer], University of Marburg, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi homepage]

7F7BC285A1D02B031575BA7E980293CD2962C84A

Page visits: 1682

Time of last update: 2022-11-29 04:56:50

Author of last update: Jstuelk