fecE

fecE
168

iron/citrate [wiki|ABC transporter] (permease)

locus
BSU_07500
Molecular weight
35.06 kDa
pI
10.06
Protein length
Gene length
function
iron uptake
product
iron/citrate [wiki|ABC transporter] (permease)
essential
no
synonyms
fecE, yfmE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0609

This gene is a member of the following regulons

Gene
Coordinates
823,716  824,717
The protein
Protein family
[wiki|Binding-protein-dependent transport system permease family] (according to UniProt)
[wiki|FecCD subfamily] (according to UniProt)
Structure
[PDB|4G1U] (from ''Yersinia pestis'', the [protein|BDAA56484E05DA3C1CB0CA09873A365657999679|fecD]-[protein|800EAB1D8617589CCAC68FB874EFCDE4C77962E1|fecE]-[protein|E76640F895261DA34AD2342B54B43D11857AEA9A|fecF] complex, 37% identity) [Pubmed|23142986]
[PDB|4R9U], the ''E. coli'' BtuC-BtuD complex, BtuC shares 35% identity, 66% similarity with YfmE, [Pubmed|25402482]
[AF|O34832]
Paralogous protein(s)
[protein|BDAA56484E05DA3C1CB0CA09873A365657999679|fecD], [protein|EC98685EE0E3CE6CE8DC33409481AE96315279AC|fhuG], [protein|34A7E22B4EF118EF5A76F8CC2DABBB023BC9A2E9|yfhA]
[wiki|Localization]
cell membrane [Pubmed|10092453]
Expression and Regulation
Operons
genes
[gene|569510093E5B69A0368205920A21A81CADF030E9|fecC]-[gene|BDAA56484E05DA3C1CB0CA09873A365657999679|fecD]-[gene|800EAB1D8617589CCAC68FB874EFCDE4C77962E1|fecE]-[gene|E76640F895261DA34AD2342B54B43D11857AEA9A|fecF]
description
[Pubmed|16672620]
regulation
immediately induced upon iron starvation (first wave to allow iron uptake) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]) [Pubmed|29133393,16672620,12354229]
regulatory mechanism
[protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]: repression, [Pubmed|16672620,12354229], in [regulon|protein:F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur regulon]
Open in new tab

[gene|569510093E5B69A0368205920A21A81CADF030E9|fecC]→[gene|E76640F895261DA34AD2342B54B43D11857AEA9A|fecF]

2022-11-28 13:17:22

Jstuelk

20

08d0c1575e8a6211c799093cfc6ee3a9c3135a88

49520E691347BD8533B6CD8A50C6130F3DA7A9DB

Biological materials
Mutant
MGNA-C245 (yfmE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2243 NBRP B. subtilis, Japan]
BKE07500 ([gene|800EAB1D8617589CCAC68FB874EFCDE4C77962E1|fecE]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE07500 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTTTGTTTTCTGGTTGTTT,  downstream forward: _UP4_AGGAAACAGTAGGGAGAGGA
BKK07500 ([gene|800EAB1D8617589CCAC68FB874EFCDE4C77962E1|fecE]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK07500 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTTTGTTTTCTGGTTGTTT,  downstream forward: _UP4_AGGAAACAGTAGGGAGAGGA
References
10092453,16672620,25402482,23142986,29133393

800EAB1D8617589CCAC68FB874EFCDE4C77962E1

Page visits: 3747

Time of last update: 2022-12-01 09:40:53

Author of last update: Melvin.boenninger