ywdA

ywdA
168

unknown

locus
BSU_38030
Molecular weight
9.42 kDa
pI
7.09
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ywdA, ipa-51d

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,901,868  3,902,116
The protein
Structure
[AF|P39609]
Expression and Regulation
Operons
genes
[gene|AE02C38397AA790E4B216BB6DBABFE907B984D05|sacP]-[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]-[gene|803ED978141A0E09F1F9CAECAB4BA839D480241F|ywdA]
description
[Pubmed|3100393]
regulation
induced by sucrose ([protein|search|SacT]) [Pubmed|2163394]
regulatory mechanism
[protein|6796E1C147AA21E919A42A953884DC24E182F430|sacT]: antitermination, via binding to a [wiki|RNA switch], in [regulon|protein:6796E1C147AA21E919A42A953884DC24E182F430|sacT regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8702561], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|AE02C38397AA790E4B216BB6DBABFE907B984D05|sacP]→[gene|803ED978141A0E09F1F9CAECAB4BA839D480241F|ywdA]

2022-11-21 19:54:23

ghost

28

84ac6df24eedff839607263961d011c324b7f03e

98AC56561C7DAA3F5751178FDFB48FF02310E968

Biological materials
Mutant
BKE38030 ([gene|803ED978141A0E09F1F9CAECAB4BA839D480241F|ywdA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE38030 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAGAAAACAACTCCTTTTA,  downstream forward: _UP4_TAAACAGGCTGCCGATGGGA
BKK38030 ([gene|803ED978141A0E09F1F9CAECAB4BA839D480241F|ywdA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK38030 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAGAAAACAACTCCTTTTA,  downstream forward: _UP4_TAAACAGGCTGCCGATGGGA
References
3100393,8702561,2163394,8702561

803ED978141A0E09F1F9CAECAB4BA839D480241F

Page visits: 1559

Time of last update: 2022-11-29 15:38:35

Author of last update: Bzhu