sspA

sspA
168

small acid-soluble spore protein (major alpha-type SASP)

locus
BSU_29570
Molecular weight
6.93 kDa
pI
4.73
Protein length
Gene length
function
protection of spore DNA
product
small acid-soluble spore protein (major alpha-type SASP)
essential
no
synonyms
sspA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5852

This gene is a member of the following regulons

Gene
Coordinates
3,025,445  3,025,654
Phenotypes of a mutant
a [gene|80B5DAED9B4BD015D877DB4819AB25FC5F165C6D|sspA] mutant is sensitive to ionizing radiation [Pubmed|24123749]
a [gene|80B5DAED9B4BD015D877DB4819AB25FC5F165C6D|sspA] [gene|28F47ADECD376494878AE58B395B3A2616B6B5DF|sspB] double mutant is sensitive to blue light-induced DNA damage [pubmed|30054368]
The protein
Protein family
[wiki|Alpha/beta-type SASP family] (according to UniProt)
Structure
[PDB|2Z3X] ([protein|9E1B3A6289F2C94F9088FA14CE8939E208DE9FEA|sspC] in complex with DNA, 83% identity)
[AF|P04831]
Modification
phosphorylated on Ser-6, Ser-9-, Ser-47, and Ser-55 [Pubmed|26381121]
phosphorylated on Arg-55 [pubmed|31221751]
Paralogous protein(s)
[protein|9E1B3A6289F2C94F9088FA14CE8939E208DE9FEA|sspC], [protein|AEFA4CE1588C7EC7FCB01312A172093D12B2B206|sspD], [protein|28F47ADECD376494878AE58B395B3A2616B6B5DF|sspB]
Expression and Regulation
Operons
genes
[gene|741DCFFBB8FF6A4E357EE5110EBE24412DE34244|nifZ]-[gene|A64A59C2B15015F13911EC53763D370F780400FD|thiI]-[gene|80B5DAED9B4BD015D877DB4819AB25FC5F165C6D|sspA]
description
[Pubmed|22383849]
Open in new tab

[gene|741DCFFBB8FF6A4E357EE5110EBE24412DE34244|nifZ]→[gene|80B5DAED9B4BD015D877DB4819AB25FC5F165C6D|sspA]

2023-02-03 13:53:26

Jstuelk

44

c96a207b604fba3a97ff9f805c130b9d09817187

28FE39136DED7BC0B197A71666940376494D0F7A

genes
[gene|80B5DAED9B4BD015D877DB4819AB25FC5F165C6D|sspA]
description
[Pubmed|3009398]
regulation
expressed late during sporulation in the forespore ([protein|search|SigG], [wiki|SpoVT]) [Pubmed|15699190,8755877]
regulatory mechanism
[protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]: activation, [Pubmed|8755877], in [regulon|protein:01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT regulon]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
additional information
the mRNA is very stable (half-life > 15 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
Open in new tab

[gene|80B5DAED9B4BD015D877DB4819AB25FC5F165C6D|sspA]

2022-12-15 04:15:18

ghost

15

33b16207360f33a7bacf9729bd8ca6ab76821ef4

C8A701BDE0BCDD5A621CF5674ECC8F5CC82DD66E

additional information
the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
Biological materials
Mutant
BP137 (''[gene|80B5DAED9B4BD015D877DB4819AB25FC5F165C6D|sspA]''::''cat'') available in [wiki|Fabian Commichau]'s lab
1S109 (no resistance), available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S109&Search=1S109 BGSC]
1S111 (no resistance), [Pubmed|3087950], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S111&Search=1S111 BGSC]
1S112 (no resistance), [Pubmed|3125155], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S112&Search=1S112 BGSC]
1S113 (no resistance), [Pubmed|3125155], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S113&Search=1S113 BGSC]
BKE29570 ([gene|80B5DAED9B4BD015D877DB4819AB25FC5F165C6D|sspA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE29570 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTGTCTCACCTCCTTGT,  downstream forward: _UP4_TAATTTACAATTTCACATAA
BKK29570 ([gene|80B5DAED9B4BD015D877DB4819AB25FC5F165C6D|sspA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK29570 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTGTCTCACCTCCTTGT,  downstream forward: _UP4_TAATTTACAATTTCACATAA
References
Reviews
35638784
Original Publications
16707666,2456528,3009398,12884008,11092849,7608092,15458366,19542328,15699190,8755877,23064347,3087950,3125155,24123749,26381121,30054368,30782632,31221751

80B5DAED9B4BD015D877DB4819AB25FC5F165C6D

Page visits: 2802

Time of last update: 2023-02-08 03:39:42

Author of last update: Jstuelk