yoyD

yoyD
168

unknown

locus
BSU_19579
Molecular weight
7.00 kDa
pI
9
Protein length
Gene length
function
unknown
product
unknown
essential
-
synonyms
yoyD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,130,177  2,130,377
The protein
Structure
[AF|C0H431]
Expression and Regulation
Operons
genes
[gene|80D8589800BC9BA6743534311B6F227A37E7DB2D|yoyD]-[gene|7E86EB6FF86F2C4AE3FD11DB8CE8E71696D94B1B|yodF]
description
[Pubmed|22383849]
regulation
expression during spore [wiki|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
regulatory mechanism
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: repression, [Pubmed|25755103,12823818], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
Open in new tab

[gene|80D8589800BC9BA6743534311B6F227A37E7DB2D|yoyD]→[gene|7E86EB6FF86F2C4AE3FD11DB8CE8E71696D94B1B|yodF]

2022-06-12 12:51:06

Jstuelk

6

b76413b76ac27cfae173804cefdd15b557151c91

D12707CF2D2A93BAD912E1DAA79938D08A9A2A7C

Biological materials
Mutant
BKE19579 ([gene|80D8589800BC9BA6743534311B6F227A37E7DB2D|yoyD]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19579 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTACTTTCCTCCTGAAA,  downstream forward: _UP4_AAAAAAGATGGAGGACTTGA
BKK19579 ([gene|80D8589800BC9BA6743534311B6F227A37E7DB2D|yoyD]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19579 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTACTTTCCTCCTGAAA,  downstream forward: _UP4_AAAAAAGATGGAGGACTTGA
References
24843172,25755103,27766092

80D8589800BC9BA6743534311B6F227A37E7DB2D

Page visits: 1237

Time of last update: 2022-06-26 09:25:38

Author of last update: Bzhu