SubtiWiki SubtiWiki
yfhI

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yfhI
168

similar to antibiotic resistance protein

locus
BSU_08540
Molecular weight
41.37 kDa
pI
9.78
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yfhI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2814

This gene is a member of the following regulons

Gene
Coordinates
926,886  928,079
The protein
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|80E461C8847BC43F7E018793E68E84C23EFBD2E9|yfhI]
description
[Pubmed|22383849]
Open in new tab

[gene|80E461C8847BC43F7E018793E68E84C23EFBD2E9|yfhI]

2021-11-06 16:13:25

Jstuelk

2

6a6613318e9648fd7f5d2125d9c632b870675443

7BEAAD30D7C9074BC5FB1F5A80A8A3B8C5B8B1D7

Biological materials
Mutant
MGNA-C362 (yfhI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2360 NBRP B. subtilis, Japan]
BKE08540 ([gene|80E461C8847BC43F7E018793E68E84C23EFBD2E9|yfhI]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08540 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACGTCATCGCCTCCTTTG,  downstream forward: _UP4_TAAAAAACAGCTGCAGTGTA
BKK08540 ([gene|80E461C8847BC43F7E018793E68E84C23EFBD2E9|yfhI]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08540 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACGTCATCGCCTCCTTTG,  downstream forward: _UP4_TAAAAAACAGCTGCAGTGTA

80E461C8847BC43F7E018793E68E84C23EFBD2E9

Page visits: 1076

Time of last update: 2021-12-20 17:19:52

Author of last update: Melvin.boenninger