sdhC

sdhC
168

succinate dehydrogenase (cytochrome b558 subunit)

locus
BSU_28450
Molecular weight
22.79 kDa
pI
9.83
Protein length
Gene length
function
TCA cycle
product
succinate dehydrogenase (cytochrome b558 subunit)
essential
no
synonyms
sdhC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2009

This gene is a member of the following regulons

Gene
Coordinates
2,908,129  2,908,737
Phenotypes of a mutant
defective in the the ability to support the growth of ''Synechococcus leopoliensis'' CCAP1405/1 on agar media [Pubmed|25875741]
defective in biofilm formation [pubmed|31420537]
The protein
Protein family
cytochrome b558 family (single member, according to UniProt)
[wiki|Cofactors]
Fe
Structure
[PDB|1NEK] (''E. coli'') [pubmed|12560550]
[AF|P08064]
Effectors of protein activity
Inhibited by 2-(n-Heptyl)-4-hydroxy-quinoline N-oxide [Pubmed|3910107]
Activated by Cytochrome b558 [Pubmed|6799760]
[wiki|Localization]
membrane protein [Pubmed|18763711]
Expression and Regulation
Operons
genes
[gene|81429F7802CD4B1F7DFDB6C900D7DA5ECA6B9F3F|sdhC]-[gene|0E1FAF4B3A967CC3882B3DDB3CA2D01FD70A0F7E|sdhA]-[gene|901F90AFC94CC7140709845333416106D043269D|sdhB]
description
[Pubmed|3036777]
regulation
constitutive
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|2495271], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|81429F7802CD4B1F7DFDB6C900D7DA5ECA6B9F3F|sdhC]→[gene|901F90AFC94CC7140709845333416106D043269D|sdhB]

2022-11-28 01:43:22

ghost

28

6e4216337509de45d76033b51f5046e391052666

7F08B53F36BD96778ADC5652AD8BF65AF07550E2

Other regulations
[protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|fsrA]: translation inhibition, [Pubmed|22389480]
additional information
highly expressed at high iron concentrations [pubmed|31420537]
Biological materials
Mutant
MGNA-B028 (sdhC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1027 NBRP B. subtilis, Japan]
GP743 ∆([gene|81429F7802CD4B1F7DFDB6C900D7DA5ECA6B9F3F|sdhC]-[gene|0E1FAF4B3A967CC3882B3DDB3CA2D01FD70A0F7E|sdhA])::cat, available in [wiki|Jörg Stülke]'s lab
GP792 ∆([gene|81429F7802CD4B1F7DFDB6C900D7DA5ECA6B9F3F|sdhC]-[gene|0E1FAF4B3A967CC3882B3DDB3CA2D01FD70A0F7E|sdhA]-[gene|901F90AFC94CC7140709845333416106D043269D|sdhB])::''phleo'', available in [wiki|Jörg Stülke]'s lab
GP2342 ∆([gene|81429F7802CD4B1F7DFDB6C900D7DA5ECA6B9F3F|sdhC]-[gene|0E1FAF4B3A967CC3882B3DDB3CA2D01FD70A0F7E|sdhA]-[gene|901F90AFC94CC7140709845333416106D043269D|sdhB])::''kan'', Cre-recombinase is integrated in [gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA], available in [wiki|Jörg Stülke]'s lab
GP2343 ∆([gene|81429F7802CD4B1F7DFDB6C900D7DA5ECA6B9F3F|sdhC]-[gene|0E1FAF4B3A967CC3882B3DDB3CA2D01FD70A0F7E|sdhA]-[[gene|sdhB]')::''lox72'', Cre-recombinase is integrated in [gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA], available in [wiki|Jörg Stülke]'s lab
BKE28450 (∆[gene|81429F7802CD4B1F7DFDB6C900D7DA5ECA6B9F3F|sdhC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE28450 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTACTTTACCCCCTGTTT,  downstream forward: _UP4_TAAGAGTACTAGATTACTAG
BKK28450 (∆[gene|81429F7802CD4B1F7DFDB6C900D7DA5ECA6B9F3F|sdhC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK28450 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTACTTTACCCCCTGTTT,  downstream forward: _UP4_TAAGAGTACTAGATTACTAG
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
References
Reviews
33705278,11803018
Original Publications
6401289,1707123,2120540,7669765,18697947,1324713,3036777,2495271,2176107,3117551,10913269,18763711,12560550,18697947,3910107,6799760,21641999,22389480,23880299,25875741,12560550,31420537

81429F7802CD4B1F7DFDB6C900D7DA5ECA6B9F3F

Page visits: 2245

Time of last update: 2022-11-28 05:40:30

Author of last update: Jstuelk