ybyB

ybyB
168

general stress protein, survival of ethanol stress

locus
BSU_02110
Molecular weight
9.72 kDa
pI
9.22
Protein length
Gene length
function
survival of ethanol stress
product
unknown
essential
no
ec
null
synonyms
ybyB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
230,819  231,079
The protein
Structure
[AF|O31441]
Expression and Regulation
Operons
genes
[gene|815996BD31BB93863BA8ABF881B7662BDD66EA0F|ybyB]
description
[pubmed|16021622]
regulation
induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]) [Pubmed|15805528]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|815996BD31BB93863BA8ABF881B7662BDD66EA0F|ybyB]

2022-12-03 02:55:40

Jstuelk

15

0069d4988870dc1d2a67fe9239f4ada859699579

221F905AA151C2E0D382B9870A2894FE7B89CB27

Biological materials
Mutant
MGNA-B974 (ybyB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1973 NBRP B. subtilis, Japan]
BKE02110 ([gene|815996BD31BB93863BA8ABF881B7662BDD66EA0F|ybyB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02110 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGTGATACTCCTTTCTA,  downstream forward: _UP4_TAATCAAAAAGCTCTCTTCG
BKK02110 ([gene|815996BD31BB93863BA8ABF881B7662BDD66EA0F|ybyB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02110 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGTGATACTCCTTTCTA,  downstream forward: _UP4_TAATCAAAAAGCTCTCTTCG
References
15805528

815996BD31BB93863BA8ABF881B7662BDD66EA0F

Page visits: 2105

Time of last update: 2022-12-06 03:42:44

Author of last update: Bzhu