dtpT
Register now for Subtillery 2022, the International Online Meeting on Bacillus subtilis! It will be held from the 19th-22th of September.

dtpT
168

proton-dependent di- and tripeptide transporter

locus
BSU_03670
Molecular weight
53.11 kDa
pI
9.92
Protein length
Gene length
function
uptake of di- and tripeptides
product
peptide transporter
essential
no
synonyms
dtpT, yclF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3104

This gene is a member of the following regulons

Gene
Coordinates
416,235  417,713
The protein
Protein family
PTR2/POT transporter (TC 2.A.17) family (single member, according to UniProt)
Structure
[PDB|4IKV], the protein from ''Geobacillus kaustophilus'' (65% identity, 87% similarity), [Pubmed|23798427]
[AF|P94408]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|819D6C5489F1F3FF63B69162EFB6581A1366F45E|dtpT]
description
[Pubmed|22383849]
regulation
repressed during exponential growth ([protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]) [Pubmed|25966844,11717292]
regulatory mechanism
[protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]: repression, [Pubmed|25966844,11717292], in [regulon|protein:F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC regulon]
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: activation, in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|25966844], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|819D6C5489F1F3FF63B69162EFB6581A1366F45E|dtpT]

2022-07-01 01:26:32

Jstuelk

5

7c22b9931473697cfcb62d0db1bf4661fa8775df

A5B1DFD7663E2A4943E9333E95C6217065E61488

additional information
the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
Biological materials
Mutant
BKE03670 ([gene|819D6C5489F1F3FF63B69162EFB6581A1366F45E|dtpT]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03670 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCAGCCAAACCCTTTC,  downstream forward: _UP4_TAATCAGAAACAGCCCGCGG
BKK03670 ([gene|819D6C5489F1F3FF63B69162EFB6581A1366F45E|dtpT]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03670 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCAGCCAAACCCTTTC,  downstream forward: _UP4_TAATCAGAAACAGCCCGCGG
References
11717292,8458848,23798427,25966844,25755103,26883633

819D6C5489F1F3FF63B69162EFB6581A1366F45E

Page visits: 2890

Time of last update: 2022-08-16 19:45:20

Author of last update: Melvin.boenninger