dtpT

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

dtpT
168

proton-dependent di- and tripeptide transporter

locus
BSU_03670
Molecular weight
53.11 kDa
pI
9.92
Protein length
Gene length
function
uptake of di- and tripeptides
product
peptide transporter
essential
no
synonyms
dtpT, yclF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3104

This gene is a member of the following regulons

Gene
Coordinates
416,235  417,713
The protein
Protein family
PTR2/POT transporter (TC 2.A.17) family (single member, according to UniProt)
Structure
[PDB|4IKV], the protein from ''Geobacillus kaustophilus'' (65% identity, 87% similarity), [Pubmed|23798427]
[AF|P94408]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|819D6C5489F1F3FF63B69162EFB6581A1366F45E|dtpT]
description
[Pubmed|22383849]
regulation
repressed during exponential growth ([protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]) [Pubmed|25966844,11717292]
regulatory mechanism
[protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]: repression, [Pubmed|25966844,11717292], in [regulon|protein:F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC regulon]
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: activation, in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|25966844], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|819D6C5489F1F3FF63B69162EFB6581A1366F45E|dtpT]

2022-03-01 15:11:30

Jstuelk

4

7c22b9931473697cfcb62d0db1bf4661fa8775df

A5B1DFD7663E2A4943E9333E95C6217065E61488

additional information
the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
Biological materials
Mutant
BKE03670 ([gene|819D6C5489F1F3FF63B69162EFB6581A1366F45E|dtpT]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03670 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCAGCCAAACCCTTTC,  downstream forward: _UP4_TAATCAGAAACAGCCCGCGG
BKK03670 ([gene|819D6C5489F1F3FF63B69162EFB6581A1366F45E|dtpT]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03670 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCAGCCAAACCCTTTC,  downstream forward: _UP4_TAATCAGAAACAGCCCGCGG
References
11717292,8458848,23798427,25966844,25755103,26883633

819D6C5489F1F3FF63B69162EFB6581A1366F45E

Page visits: 2713

Time of last update: 2022-05-26 08:01:33

Author of last update: Melvin.boenninger