

(p)ppGpp synthetase, contributes to cellular heterogeneity in protein synthesis during nutrient limitation

Molecular weight
24.56 kDa
Protein length
Gene length
ppGpp synthesis independent from stringent response
(p)ppGpp synthetase
sasB, yjbM, relQ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2357

This gene is a member of the following regulons

1,237,006  1,237,641
Phenotypes of a mutant
a [gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|rel] [gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA] [gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB] triple mutant requires branched chain amino acids, methionine and threonine for growth, the requirement can be suppressed by reduced expression of [gene|AB3D18228DB6819B0C81BC7A8BB3408A4F75DC0C|guaB] or inactivation of [gene|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY] [Pubmed|24163341]
a [gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|rel] [gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA] [gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB] triple mutant acquires suppressor mutations in [gene|AC67305E4C165CC1D785E49B7CD8335346134376|guaA], [gene|AB3D18228DB6819B0C81BC7A8BB3408A4F75DC0C|guaB], [gene|1BC994DE60A7BB35DEDD7154581A396D29AA94A7|gmk] or inactivation of [gene|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY] [Pubmed|24682323,24163341]
The protein
Catalyzed reaction/ biological activity
ATP + GTP --> AMP + guanosine 3'-diphosphate 5'-triphosphate (according to UniProt)
Protein family
RelA/SpoT family (with [protein|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA] and [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|rel], according to UniProt)
single ppGpp synthetase domain [Pubmed|24163341]
[PDB|5DEC] [Pubmed|26460002]
Effectors of protein activity
allosterically activated by pppGpp [Pubmed|26460002], this is inhibited by the [protein|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA] product pGpp [pubmed|35594298]
Paralogous protein(s)
Expression and Regulation
expressed during exponential growth
Open in new tab


2022-09-06 18:51:47





Biological materials
MGNA-B159 (yjbM::erm), available at the [ NBRP B. subtilis, Japan]
GP2066 ([gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA] [gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB] [gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|rel]::mls), available in [wiki|Jörg Stülke]'s lab
BKE11600 ([gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCATACATCCCCCAATTC,  downstream forward: _UP4_CAATAGGTAAAGGGGAAGAA
BKK11600 ([gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCATACATCCCCCAATTC,  downstream forward: _UP4_CAATAGGTAAAGGGGAAGAA
GP3470 (Δ[gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA]::spec Δ[gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB]::phleo), available in [wiki|Jörg Stülke]'s lab
GP3472 (Δ[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|rel]::cat Δ[gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB]::phleo), available in [wiki|Jörg Stülke]'s lab
GP3425 (Δ[gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB]::phleo) , available in [wiki|Jörg Stülke]'s lab
GP3467 ([gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB]-6xHis-cat), available in [wiki|Jörg Stülke]'s lab
Expression vectors
pGP3452 (N-terminal 6xHis-SUMO-tag, purification from E. coli, in pET-SUMO), available in [wiki|Jörg Stülke]'s lab
two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
lacZ fusion
GP3693 (based on [wiki|pAC7]), available in [wiki|Jörg Stülke]'s lab
Original Publications


Page visits: 3088

Time of last update: 2022-10-03 20:01:28

Author of last update: Jstuelk