sdpC

sdpC
168

toxin, collapses the proton motive force and induces autolysis, kills non-sporulating cells, induces activity of [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]

locus
BSU_33770
Molecular weight
22.07 kDa
pI
9.61
Protein length
Gene length
function
killing of non-sporulating sister cells
product
toxin, kills non-sporulating cells
essential
no
synonyms
sdpC, yvaY

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,465,776  3,466,387
The protein
Catalyzed reaction/ biological activity
toxin, collapses the proton motive force and induces autolysis [Pubmed|22469514]
Structure
[AF|O34344]
Modification
the mature SDP is a 42-residue peptide with one disulfide bridge [Pubmed|20805502]
Paralogous protein(s)
[protein|330CB6A25181F7AFD3C63F73CA21A3428882D100|yitM]
[wiki|Localization]
secreted (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|219092C574A13B81CD312AEB55BAE48A3C541FB7|sdpA]-[gene|073D63E17C8248BE39F331FDE9902E21A34056D5|sdpB]-[gene|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|sdpC]
description
[Pubmed|12817086]
regulation
expressed under conditions that trigger sporulation ([wiki|Spo0A]) [pubmed|14651647,15687200]
expression
expression is heterogeneous [pubmed|35171018]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: activation, [PubMed|14651647,15687200], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok]: repression, [Pubmed|15743949], in [regulon|protein:1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [PubMed|15687200,17720793], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
additional information
the amount of the mRNA is substantially decreased upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
Open in new tab

[gene|219092C574A13B81CD312AEB55BAE48A3C541FB7|sdpA]→[gene|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|sdpC]

2022-11-26 14:45:06

Jstuelk

40

2FCAA28FD6DF9E360EB7B7713A66BCCA85A76C64

29EABA10B87FFC2DBA2CD17C1DA823E6512A5B7B

Biological materials
Mutant
MGNA-A452 (yvaY::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/452 NBRP B. subtilis, Japan]
BKE33770 ([gene|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|sdpC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE33770 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATTATTATACCTCCATT,  downstream forward: _UP4_TAATCCATTATAATTGAGTG
BKK33770 ([gene|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|sdpC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK33770 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATTATTATACCTCCATT,  downstream forward: _UP4_TAATCCATTATAATTGAGTG
References
Reviews
20955377
Original Publications
12817086,16469701,16629676,13129613,14651647,15687200,15743949,15687200,17720793,12107147,22469514,20805502,23687264,21815947

820635420B3980B620F3E3D7ACF7EDE9DC6275AD

Page visits: 3392

Time of last update: 2022-11-26 12:07:47

Author of last update: Jstuelk