SubtiWiki SubtiWiki
yfjP

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yfjP
168

similar to DNA-3-methyladenine glycosidase II

locus
BSU_08010
Molecular weight
33.03 kDa
pI
5.52
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
3.2.2.21
synonyms
yfjP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0122

This gene is a member of the following regulons

Gene
Coordinates
872,425  873,288
The protein
Catalyzed reaction/ biological activity
Hydrolysis of alkylated DNA, releasing 3-methyladenine, 3-methylguanine, 7-methylguanine and 7-methyladenine (according to UniProt)
Protein family
alkylbase DNA glycosidase AlkA family (with [protein|297DF91EF3E91A6D2DC39BBC7FE8711AB7EBE509|alkA], according to UniProt)
Structure
[PDB|2H56] (from B. halodurans, corresponds to aa 119 ... 285, 29% identity)
Expression and Regulation
Operons
genes
[gene|82CDC97D16426016CA7E75240C1A6D0D600F4375|yfjP]-[gene|05392BB2C32B0405799D4F34E5BA55FC936AB943|yfjO]
description
[pubmed|22383849]
Open in new tab

[gene|82CDC97D16426016CA7E75240C1A6D0D600F4375|yfjP]→[gene|05392BB2C32B0405799D4F34E5BA55FC936AB943|yfjO]

2021-10-19 03:17:28

Jstuelk

3

f0780656463c19550802ca69fcbe4c22787f1b22

5E8CA0DFBDB527F0A8E65EB56DDFD85DEB8250F8

Biological materials
Mutant
MGNA-C275 (yfjP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2273 NBRP B. subtilis, Japan]
BKE08010 ([gene|82CDC97D16426016CA7E75240C1A6D0D600F4375|yfjP]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08010 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAGATCCACCCTTTTTT,  downstream forward: _UP4_TAATTCGTCTGACAATGAAG
BKK08010 ([gene|82CDC97D16426016CA7E75240C1A6D0D600F4375|yfjP]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08010 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAGATCCACCCTTTTTT,  downstream forward: _UP4_TAATTCGTCTGACAATGAAG
References
Reviews
22933559

82CDC97D16426016CA7E75240C1A6D0D600F4375

Page visits: 721

Time of last update: 2021-12-28 18:46:43

Author of last update: Jstuelk