SubtiWiki SubtiWiki
yvgO

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yvgO
168

general stress protein, survival of ethanol stress

locus
BSU_33410
Molecular weight
17.46 kDa
pI
4.85
Protein length
Gene length
function
survival of ethanol stress
product
unknown
essential
no
ec
null
synonyms
yvgO

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,427,802  3,428,287
The protein
[wiki|Localization]
extracellular (signal peptide) [Pubmed|18957862]
Expression and Regulation
Operons
genes
[gene|833C00D080B432A29B2D06752F8457225F73862F|yvgO]
description
[Pubmed|22383849]
regulation
induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]) [Pubmed|15805528]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|833C00D080B432A29B2D06752F8457225F73862F|yvgO]

2022-01-11 07:55:01

Jstuelk

6

a2f169194c57c594789c67d91eda961eda1ed226

95E945C29B2570B68E6CAE9D7D1FE8BA2D3571B8

Biological materials
Mutant
MGNA-B060 (yvgO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1059 NBRP B. subtilis, Japan]
BKE33410 ([gene|833C00D080B432A29B2D06752F8457225F73862F|yvgO]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33410 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAGTTGTTTCCTCCTTTGT,  downstream forward: _UP4_TAATATAAAAAAAGCTGGCG
BKK33410 ([gene|833C00D080B432A29B2D06752F8457225F73862F|yvgO]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33410 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAGTTGTTTCCTCCTTTGT,  downstream forward: _UP4_TAATATAAAAAAAGCTGGCG
References
18957862,15805528,20817675

833C00D080B432A29B2D06752F8457225F73862F

Page visits: 1082

Time of last update: 2022-01-19 13:32:03

Author of last update: Bzhu