licC

licC
168

lichenan-specific permease of the [wiki|phosphotransferase systems|phosphotransferase system], EIIC of the [category|SW.1.2.2|PTS]

locus
BSU_38580
Molecular weight
48.37 kDa
pI
8.58
Protein length
Gene length
function
lichenan uptake and phosphorylation
product
lichenan-specific lichenan-specific [category|SW.1.2.2|PTS], EIIC component
essential
no
synonyms
licC, celB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1455

This gene is a member of the following regulons

Gene
Coordinates
3,960,192  3,961,550
The protein
Protein family
[category|SW.1.2.2|PTS] permease, lactose family [Pubmed|10627040]
[wiki|Domains]
[wiki|PTS EIIC domain] type-3 (aa 8-421) (according to UniProt)
Structure
[PDB|3QNQ] (EIIC component of diacetylchitobiose specific PTS from ''Bacillus cereus''; 60% identity, 87% similarity) [Pubmed|21471968]
[AF|P46317]
Paralogous protein(s)
[protein|0650C9EAB395EB6ABDADBE72F0DA9F8E5E606B0E|ywbA], [protein|76324E0A6CAA8E1DD0B0C6FAE1CAB402231BF7CC|gmuC]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|65FC7F4ED92F747DB7BC5672DCA2D2320A471134|licB]-[gene|83A7C160B0301A2B51B65478D99ACB753D67AF74|licC]-[gene|E8B6C8E722BEE866878CDD816B7828C132F94FCD|licA]-[gene|84D8AA0AFBF46273F6B4198B49440D55470FEC0F|licH]
description
[Pubmed|8990303]
regulation
carbon catabolite repression ([protein|search|CcpA]) [Pubmed|8990303]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|8990303], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|licR]: activation, [Pubmed|8990303], in [regulon|protein:E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|licR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8990303], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|65FC7F4ED92F747DB7BC5672DCA2D2320A471134|licB]→[gene|84D8AA0AFBF46273F6B4198B49440D55470FEC0F|licH]

2022-11-25 12:14:04

ghost

26

71a5a6a29188848adbfdb06b462667b975c2c7f8

DF3BDC652C79EB094E8D2D2CE50175B714C16E84

Biological materials
Mutant
BKE38580 ([gene|83A7C160B0301A2B51B65478D99ACB753D67AF74|licC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE38580 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACATAGCCCGCCCCTCTCT,  downstream forward: _UP4_CTGTAGAGAAAGGAAGTGAA
BKK38580 ([gene|83A7C160B0301A2B51B65478D99ACB753D67AF74|licC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK38580 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACATAGCCCGCCCCTCTCT,  downstream forward: _UP4_CTGTAGAGAAAGGAAGTGAA
References
19087206,8990303,16872404,10438772,10627040,8990303

83A7C160B0301A2B51B65478D99ACB753D67AF74

Page visits: 2293

Time of last update: 2022-11-27 10:56:52

Author of last update: Melvin.boenninger