rsbS
Register now for Subtillery 2022, the International Online Meeting on Bacillus subtilis! It will be held from the 19th-22th of September.

rsbS
168

part of the [wiki|stressosome], control of [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB] activity

locus
BSU_04680
Molecular weight
13.17 kDa
pI
4.14
Protein length
Gene length
function
control of [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB] activity
product
scaffold protein of the stressosome, anti-[protein|ADC52A22950736A0435AEEEC43F7407878786A81|rsbT]
essential
no
synonyms
rsbS, ycxS

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1366

This gene is a member of the following regulons

Gene
Coordinates
520,237  520,602
The protein
[wiki|Domains]
[wiki|STAS domain] (aa 4-115) (according to UniProt)
Structure
[PDB|3VY9] (complete stressosome)
[PDB|6JHK]
[AF|P42410]
Modification
phosphorylation on Ser-59 by [protein|ADC52A22950736A0435AEEEC43F7407878786A81|rsbT] [Pubmed|17218307], dephosphorylation by [protein|8536803BDFB58D43C52961931F609933E49E989D|rsbX] [Pubmed|21362065]
Expression and Regulation
Operons
genes
[gene|621357D1FB6AC1B0499732EFE226F982B26CE34E|rsbR]-[gene|841CE7FCA4E84445830CA18F9856F6F30014E3BB|rsbS]-[gene|ADC52A22950736A0435AEEEC43F7407878786A81|rsbT]-[gene|0B8381D2C724DAA724E4AFC67000F12AD112D13D|rsbU]-[gene|AC64DA463250A090A62E50901EFE653C8F963872|rsbV]-[gene|5AF5F199C5D92E13DE1C56E28948A557E3954CBF|rsbW]-[gene|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]-[gene|8536803BDFB58D43C52961931F609933E49E989D|rsbX]
description
[Pubmed|8002610]
regulation
''[protein|search|rsbV]:'' induced by stress ([protein|search|SigB]) [Pubmed|11544224]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|20454630], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8002610], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|11544224], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|621357D1FB6AC1B0499732EFE226F982B26CE34E|rsbR]→[gene|8536803BDFB58D43C52961931F609933E49E989D|rsbX]

2022-08-02 18:49:42

ghost

34

5f220975cc2493224a8aa0770ee2187c815a2127

3EFC8DC1AC54632D4F2AC30497749AB5CCA3A39F

Biological materials
Mutant
BKE04680 ([gene|841CE7FCA4E84445830CA18F9856F6F30014E3BB|rsbS]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CGGGATTTTCGGATGTCTCA,  downstream forward: _UP4_AAGCGGGAATTGGGGGAATA
BKK04680 ([gene|841CE7FCA4E84445830CA18F9856F6F30014E3BB|rsbS]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CGGGATTTTCGGATGTCTCA,  downstream forward: _UP4_AAGCGGGAATTGGGGGAATA
labs
[wiki|Bill Haldenwang], San Antonio, USA
[wiki|Chet Price], Davis, USA [http://foodscience.ucdavis.edu/price_lab/pricelab.html homepage]
[wiki|Rick Lewis], Newcastle, UK [http://www.ncl.ac.uk/camb/staff/profile/r.lewis homepage]
References
Reviews
19704888,16319496,20658979,28271471,33042030
Original Publications
8002610,8682769,9786195,8682789,10781545,15583165,8824586,10329124,17158665,21821766,16321960,10671474,8808936,15312768,11244072,15342582,16321960,8955331,12950928,15466036,9179850,18832644,17218307,20019076,24599254,23320651,21362065,28727759,28727759

841CE7FCA4E84445830CA18F9856F6F30014E3BB

Page visits: 2110

Time of last update: 2022-08-06 22:53:52

Author of last update: Jstuelk