yuaD

yuaD
168

unknown

locus
BSU_31040
Molecular weight
21.16 kDa
pI
8.06
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yuaD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2258

This gene is a member of the following regulons

Gene
Coordinates
3,183,201  3,183,779
The protein
[wiki|Domains]
MOSC domain (aa 15-179) (according to UniProt)
Structure
[PDB|1ORU]
[AF|O32079]
Expression and Regulation
Operons
genes
[gene|842CC1FA5050C1832AB82FE149FD8167D5BF294B|yuaD]
description
[Pubmed|22383849]
Open in new tab

[gene|842CC1FA5050C1832AB82FE149FD8167D5BF294B|yuaD]

2022-05-16 19:41:48

Jstuelk

5

18e14c6e85d0dd4decf06f085280dd50705a113a

6B1F320FA6ECED4BDEC7428959875FDC9CDB7E87

Biological materials
Mutant
MGNA-B542 (yuaD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1541 NBRP B. subtilis, Japan]
BKE31040 ([gene|842CC1FA5050C1832AB82FE149FD8167D5BF294B|yuaD]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31040 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCAGCTGGCACCTTCCTT,  downstream forward: _UP4_AAAGCAGAAAGGGTCTGATT
BKK31040 ([gene|842CC1FA5050C1832AB82FE149FD8167D5BF294B|yuaD]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31040 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCAGCTGGCACCTTCCTT,  downstream forward: _UP4_AAAGCAGAAAGGGTCTGATT

842CC1FA5050C1832AB82FE149FD8167D5BF294B

Page visits: 884

Time of last update: 2022-06-25 07:35:45

Author of last update: Melvin.boenninger