prpC

prpC
168

protein phosphatase

locus
BSU_15760
Molecular weight
27.52 kDa
pI
4.36
Protein length
Gene length
function
antagonist of PrkC-dependent phosphorylation
product
protein phosphatase
essential
no
ec
3.1.3.16
synonyms
prpC, yloO

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0631

This gene is a member of the following regulons

Gene
Coordinates
1,650,384  1,651,148
Phenotypes of a mutant
A ''prpC'' mutant is less lytic in late stationary phase. [Pubmed|12399479]
inactivation of ''[gene|84447F9A6644EA8A7593BB99B2B69D4377E670E2|prpC]'' reduces sporulation efficiency to 50.7% that of wild type cells [Pubmed|26735940]
The protein
Catalyzed reaction/ biological activity
dephosphorylation of [gene|E771685D6D41D48E0C0AF77F15B4F380820FCDC2|EF-tu]]]-Thr63-P [Pubmed|26056311]
H2O + O-phospho-L-seryl-[protein] --> L-seryl-[protein] + phosphate (according to UniProt)
H2O + O-phospho-L-threonyl-[protein] --> L-threonyl-[protein] + phosphate (according to UniProt)
[wiki|Domains]
[wiki|PPM-type phosphatase domain] (aa 2-243) (according to UniProt)
[wiki|Cofactors]
divalent cations such as magnesium or manganese
Structure
[PDB|1TXO] (from ''Mycobacterium tuberculosis'', 34% identity, 54% similarity) [Pubmed|15530359]
[AF|O34779]
Effectors of protein activity
inhibited by inorganic phosphate and glycero-2-phosphate [Pubmed|16857667]
Expression and Regulation
Operons
genes
[gene|84447F9A6644EA8A7593BB99B2B69D4377E670E2|prpC]-[gene|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|prkC]-[gene|519D4694B2895EE6F0D38D918F52F27734506848|cpgA]-[gene|8103B8539338B77CF51B16B7FA76783ED2319F13|rpeA]-[gene|0ACE023DCD6A6BB5A1827D1D997BDFAC3B168C51|yloS]
description
[Pubmed|22383849]
Open in new tab

[gene|84447F9A6644EA8A7593BB99B2B69D4377E670E2|prpC]→[gene|0ACE023DCD6A6BB5A1827D1D997BDFAC3B168C51|yloS]

2022-11-30 16:10:37

Jstuelk

57

f45e3810755c3fba238243b21c1c17e072c8fe47

14D2827FA6BD60210DFADC1BB1FFF0C98DC768FA

Biological materials
Mutant
MGNA-B133 (yloO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1132 NBRP B. subtilis, Japan]
OMG401 (aphA3), available in [wiki|Jörg Stülke]'s lab
1A962 (no resistance), [Pubmed|12399479], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A962&Search=1A962 BGSC]
1A964 (no resistance), [Pubmed|12399479], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A964&Search=1A964 BGSC]
BKE15760 ([gene|84447F9A6644EA8A7593BB99B2B69D4377E670E2|prpC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE15760 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTTAAGGCTGTTAACAACC,  downstream forward: _UP4_CAAGTTGAAGAGGGTGAAGA
BKK15760 ([gene|84447F9A6644EA8A7593BB99B2B69D4377E670E2|prpC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK15760 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTTAAGGCTGTTAACAACC,  downstream forward: _UP4_CAAGTTGAAGAGGGTGAAGA
References
Reviews
21372323
Original Publications
19246764,10986276,17693724,12399479,18757537,15530359,23793375,16025310,24390483,25012659,26056311,26735940,27806131

84447F9A6644EA8A7593BB99B2B69D4377E670E2

Page visits: 1883

Time of last update: 2022-11-30 08:27:26

Author of last update: Melvin.boenninger