yaaC

yaaC
168

unknown

locus
BSU_00080
Molecular weight
37.82 kDa
pI
7.79
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yaaC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
14,847  15,794
The protein
Structure
[AF|P37526]
Expression and Regulation
Operons
genes
[gene|84A74D4CA5812B7E737F28362411EA55685671E9|yaaC]
description
(chromosomal arrangement) null
Open in new tab

[gene|84A74D4CA5812B7E737F28362411EA55685671E9|yaaC]

2022-11-28 16:41:31

ghost

27

de14fb3d56dbf297c7d37491a935e76bb236e1b8

9A5C58804AB84F69485A5BADD08EBBF7E0F82261

Biological materials
Mutant
MGNA-B886 (yaaC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1885 NBRP B. subtilis, Japan]
BKE00080 ([gene|84A74D4CA5812B7E737F28362411EA55685671E9|yaaC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE00080 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTATATTTCTTAATCCT,  downstream forward: _UP4_TAACAAACAAAAAACCCAGC
BKK00080 ([gene|84A74D4CA5812B7E737F28362411EA55685671E9|yaaC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK00080 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTATATTTCTTAATCCT,  downstream forward: _UP4_TAACAAACAAAAAACCCAGC

84A74D4CA5812B7E737F28362411EA55685671E9

Page visits: 1326

Time of last update: 2022-12-01 17:01:00

Author of last update: Bzhu