


Molecular weight
35.60 kDa
Protein length
Gene length

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1846

This gene is a member of the following regulons

235,965  236,882
The protein
[wiki|HTH marR-type domain] (aa 1-140) (according to UniProt)
[wiki|N-acetyltransferase domain] (aa 153-303) (according to UniProt)
Expression and Regulation
Open in new tab


2022-10-23 03:34:30





Open in new tab


2022-11-17 07:53:16





Biological materials
MGNA-B964 (ybfA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1963 NBRP B. subtilis, Japan]
BKE02160 ([gene|84BD1259552AAC6FBDE42221B42F57DEFF3622E8|ybfA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02160 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATCAATTCCCACTTTCT,  downstream forward: _UP4_GAACGGTGGGATTTGGAGCT
BKK02160 ([gene|84BD1259552AAC6FBDE42221B42F57DEFF3622E8|ybfA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02160 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATCAATTCCCACTTTCT,  downstream forward: _UP4_GAACGGTGGGATTTGGAGCT


Page visits: 1081

Time of last update: 2022-11-27 02:40:03

Author of last update: Melvin.boenninger