ctpB

ctpB
168

carboxy-terminal processing serine protease, cleaves [protein|AB2A3422277040107AAF90358BBE58608F8E0738|spoIVFA], this results in processing of pro-[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]

locus
BSU_35240
Molecular weight
52.63 kDa
pI
8.64
Protein length
Gene length
function
control of [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK] activation
product
carboxy-terminal processing serine protease, cleaves [protein|AB2A3422277040107AAF90358BBE58608F8E0738|spoIVFA]
essential
no
synonyms
ctpB, yvjB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0793

This gene is a member of the following regulons

Gene
Coordinates
3,622,356  3,623,798
The protein
Catalyzed reaction/ biological activity
The enzyme shows specific recognition of a C-terminal tripeptide, Xaa-Yaa-Zaa, in which Xaa is preferably Ala or Leu, Yaa is preferably Ala or Tyr, and Zaa is preferably Ala, but then cleaves at a variable distance from the C-terminus. A typical cleavage is -Ala-Ala-|-Arg-Ala-Ala-Lys-Glu-Asn-Tyr-Ala-Leu-Ala-Ala (according to UniProt)
Protein family
Peptidase s41a family (together with [protein|5ED8301B9681FDD5171A9344A971E891493A6558|ctpA], according to Uniprot)
PDZ protease [Pubmed|24243021]
[wiki|Domains]
signal peptide (aa 1 - 23) (according to Uniprot)
[wiki|PDZ domain] (aa 92 - 182) (according to Uniprot)
S41 peptidase domain (by similarity to [protein|5ED8301B9681FDD5171A9344A971E891493A6558|ctpA]) [pubmed|29979679]
peptidoglycan binding domain (C-terminal) (by similarity to [protein|5ED8301B9681FDD5171A9344A971E891493A6558|ctpA]) [pubmed|29979679]
Structure
[PDB|4C2C] [Pubmed|24243021]
forms a ring-like scaffold with two narrow tunnels for substrate binding [Pubmed|24243021]
[AF|O35002]
Effectors of protein activity
substrate binding of CtpB induces opening of the PDZ gate and protease activation [Pubmed|24243021]
[protein|85247AD09B7A472607B32D57E6318BA6C83EC6BA|ctpB] acts in concert with a second signaling protease, [protein|DBB3ED60A7D162B9F2830F81041BC661AA5EC1E7|spoIVB] [Pubmed|24243021]
Paralogous protein(s)
[protein|5ED8301B9681FDD5171A9344A971E891493A6558|ctpA]
[wiki|Localization]
intracellular space between the mother cell and the forespore [Pubmed|24243021]
Expression and Regulation
Operons
genes
[gene|85247AD09B7A472607B32D57E6318BA6C83EC6BA|ctpB]
description
[Pubmed|22383849]
regulation
expressed during sporulation ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE], [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]) [Pubmed|15699190,16497325]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|15699190], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190,16497325], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|85247AD09B7A472607B32D57E6318BA6C83EC6BA|ctpB]

2022-12-30 13:18:45

Jstuelk

37

35d56590ec4e5fd0e7aad417ddf7b72138ddc8e2

A97C4B6A36FB3DEB91CF6CED6AC72427C8BAC58B

Biological materials
Mutant
MGNA-A074 (yvjB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/74 NBRP B. subtilis, Japan]
1S129 ( ''ctpB''::''tet''), [Pubmed|14526016], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S129&Search=1S129 BGSC]
BKE35240 ([gene|85247AD09B7A472607B32D57E6318BA6C83EC6BA|ctpB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE35240 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCTTTACTCCTCCTGTA,  downstream forward: _UP4_TAAAGGAGATGGTATTTCAT
BKK35240 ([gene|85247AD09B7A472607B32D57E6318BA6C83EC6BA|ctpB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK35240 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCTTTACTCCTCCTGTA,  downstream forward: _UP4_TAAAGGAGATGGTATTTCAT
References
Reviews
31350897,33538382,34410368,35638784
Original Publications
14526016,17557826,16818230,15699190,16497325,24243021

85247AD09B7A472607B32D57E6318BA6C83EC6BA

Page visits: 2473

Time of last update: 2023-02-07 02:02:46

Author of last update: Jstuelk