

dipeptide [wiki|ABC transporter] (dipeptide-binding protein)

Molecular weight
62.41 kDa
Protein length
Gene length
uptake of dipeptides
dipeptide [wiki|ABC transporter] (dipeptide-binding protein)
dppE, dciAE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4166

This gene is a member of the following regulons

1,364,151  1,365,800
The protein
Protein family
[wiki|bacterial solute-binding protein 5 family] (according to UniProt)
[PDB|4FAJ] (from Enterococcus faecalis, 33% identity) [pubmed|22948145]
Paralogous protein(s)
attached to the cell membrane (via [protein|062AE5FB4C778178A7F6833CB8BD9D631E461E89|dppB]-[protein|EDF8D2C49FA5552B24135E12524F9035E1E01473|dppC]) [Pubmed|10092453,18763711]
Expression and Regulation
repressed by glucose (2.9-fold) [Pubmed|12850135]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|7783641], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1766371], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2022-11-21 12:41:52





regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|12618455], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
Open in new tab


2022-11-21 06:17:37





Biological materials
GP1110 (spc), available in [wiki|Jörg Stülke]'s lab
1A737 ( ''dppE''::''kan''), [Pubmed|1766370], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A737&Search=1A737 BGSC]
BKE12960 ([gene|853C570CFB9382449A20BE77B44B4FE44972AA59|dppE]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE12960 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCTCTTCCCCCTTTTCA,  downstream forward: _UP4_TGATGGAGGCGATTGAGGAA
BKK12960 ([gene|853C570CFB9382449A20BE77B44B4FE44972AA59|dppE]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK12960 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCTCTTCCCCCTTTTCA,  downstream forward: _UP4_TGATGGAGGCGATTGAGGAA


Page visits: 3492

Time of last update: 2022-11-27 11:31:18

Author of last update: Melvin.boenninger