

D-alanine carrier protein, alanylation of teichoic acid provides some resistance against positively charged antimicrobial peptides

Molecular weight
8.87 kDa
Protein length
Gene length
biosynthesis of teichoic acid
D-alanine carrier protein
dltC, ipa-3r

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0236

This gene is a member of the following regulons

3,954,987  3,955,223
Phenotypes of a mutant
more sensitive to nisin [Pubmed|23980836]
The protein
Protein family
DltC family (single member, according to UniProt)
[wiki|Carrier domain] (aa 1-78) (according to UniProt)
[PDB|4BPG] [Pubmed|26193422]
modified with the 4-phosphopantetheine (Ppant) group at Ser35, by [protein|200BE4802FCE3C860565B374EAADC9C1FEEF3E49|acpS] [pubmed|30283133], then further modified with a d-alanyl group by [protein|795CD64B65D7CBF26E5F706C7617196CC6FCF864|dltA], through a thioester bond [pubmed|30283133]
cytoplasm (according to UniProt)
Expression and Regulation
expression is reduced in a [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|sigV] mutant [Pubmed|21926231]
the mRNA is processed between [gene|459ED28A98F4EC7E8A9016C742DC8EB5C26B5E65|ywzH] and [gene|795CD64B65D7CBF26E5F706C7617196CC6FCF864|dltA] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|ymcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|ylbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT] complex [Pubmed|29794222]
regulatory mechanism
[protein|7098319D8E88FDC2A629A3F4A21507FD7A649385|yvrHb]: activation, [Pubmed|16306698], in [regulon|protein:7098319D8E88FDC2A629A3F4A21507FD7A649385|yvrHb regulon]
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: repression, [Pubmed|7797557], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
stringent response: negative regulation, in [regulon|other_regulator:stringent response|stringent response]
sigma factors
[protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]: sigma factor, [Pubmed|7797557], in [regulon|protein:7024E4162A6D827069F882FDEACA696EBC05DD40|sigD regulon]
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|18179421], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
[protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]: sigma factor, [Pubmed|14762009], in [regulon|protein:E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX regulon]
[protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|sigV]: sigma factor, [Pubmed|21926231], in [regulon|protein:D04629D798E458AD538809BB2B150B7FA81D2C7E|sigV regulon]
Open in new tab


2022-11-29 16:15:14





Biological materials
BKE38520 ([gene|862D977CF1E185597329A1EF0915485F72482A03|dltC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE38520 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AAAATCCATAGCTTTCTAAT,  downstream forward: _UP4_AATCAGCTGTCTGAGTTGAA
BKK38520 ([gene|862D977CF1E185597329A1EF0915485F72482A03|dltC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK38520 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AAAATCCATAGCTTTCTAAT,  downstream forward: _UP4_AATCAGCTGTCTGAGTTGAA
Original Publications


Page visits: 2069

Time of last update: 2022-11-29 14:22:26

Author of last update: Melvin.boenninger