SubtiWiki SubtiWiki

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!


general stress protein, similar to tellurium resistance protein

Molecular weight
20.80 kDa
Protein length
Gene length
required for survival of ethanol stress and at low temperatures

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2310

This gene is a member of the following regulons

313,396  313,974
The protein
Protein family
CAPAB/TerDEXZ family (with [protein|7E4742F30B4C43FBF9DAE0B02948022AE7912A33|yceC] and [protein|DF30A8B195B8D830E131B23C768F07BE61F51150|yceD], according to UniProt)
[PDB|2KXT] (from Klebsiella pneumoniae, 54% identity) [pubmed|21112337]
phosphorylated on Arg-10 [Pubmed|22517742]
Paralogous protein(s)
[protein|DF30A8B195B8D830E131B23C768F07BE61F51150|yceD], [protein|7E4742F30B4C43FBF9DAE0B02948022AE7912A33|yceC]
Expression and Regulation
induced by stress ([protein|search|SigB]) [Pubmed|11544224]
sigma factors
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|18179421], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, [Pubmed|11866510], in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|11544224,15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
[protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]: sigma factor, [Pubmed|19047346], in [regulon|protein:E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX regulon]
Open in new tab


2021-11-18 10:45:44





Biological materials
MGNA-B985 (yceE::erm), available at the [ NBRP B. subtilis, Japan]
BKE02910 ([gene|863E26D497D29B820912A0C0F4A3AE4C6865EC2E|yceE]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACTGCCTCTCTCCTTTC,  downstream forward: _UP4_TAAGCGAGTGACAAATAGAG
BKK02910 ([gene|863E26D497D29B820912A0C0F4A3AE4C6865EC2E|yceE]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACTGCCTCTCTCCTTTC,  downstream forward: _UP4_TAAGCGAGTGACAAATAGAG


Page visits: 1589

Time of last update: 2022-01-19 02:49:56

Author of last update: Melvin.boenninger