yjbH

yjbH
168

adaptor protein for [protein|297F53DAD3351E0C55108DD2C93B78FFB174438C|clpX]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP]-catalyzed [protein|2C6386E9A63F410558D168798D077DF91590F454|spx] degradation, confers resistance against nitrosating agents

locus
BSU_11550
Molecular weight
31.33 kDa
pI
5.21
Protein length
Gene length
function
stimulation of [protein|2C6386E9A63F410558D168798D077DF91590F454|spx] degradation
product
adaptor protein
essential
no
synonyms
yjbH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2761

This gene is a member of the following regulons

Gene
Coordinates
1,233,614  1,234,513
Phenotypes of a mutant
increased thermotolerance due to increased stabiliy of [protein|2C6386E9A63F410558D168798D077DF91590F454|spx] and thus increased expression of ''[gene|4E5C84FDC8FE2FEFF47306C91ECAB7F17D3E38E9|trxA]'' [Pubmed|24417481]
defective in [category|SW.4.1.4|Swarming] motility (periodic cessation and reinitiation of [category|SW.4.1.4|Swarming] motility, terracing colonies) [pubmed|35638827]
The protein
Catalyzed reaction/ biological activity
adaptor protein for [protein|297F53DAD3351E0C55108DD2C93B78FFB174438C|clpX]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP]-catalyzed [protein|2C6386E9A63F410558D168798D077DF91590F454|spx] degradation [Pubmed|19074380]
Protein family
UPF0413 family (single member, according to UniProt)
[wiki|Cofactors]
contains Zn atoms (coordinated by the N-terminal His-rich region) [Pubmed|19074380]
Structure
[PDB|6GHB] (oxidized Geobacillus kaustophilus protein complexed with B. subtilis Spx) [Pubmed|30982633]
[PDB|6GHO] (Geobacillus kaustophilus protein complexed with B. subtilis Spx) [Pubmed|30982633]
[AF|O31606]
Effectors of protein activity
[protein|87124945A1CBF7990856FBEB9EAD25096DAC0868|yjbH] aggregates under stress conditions, resulting in the inability to bind to [protein|2C6386E9A63F410558D168798D077DF91590F454|spx], and therefore in stabilization of [protein|2C6386E9A63F410558D168798D077DF91590F454|spx] [Pubmed|25353645]
Zn atom is released upon treatment with strong oxidants [Pubmed|19074380]
interaction with [protein|5EC57A51EF2DC48070615653B7A3C1007CFEE01D|yirB] inhibits the formation of a complex with [protein|2C6386E9A63F410558D168798D077DF91590F454|spx] [Pubmed|21378193]
[wiki|Localization]
cytosolic protein
Expression and Regulation
Operons
genes
[gene|948BD57CC45915C7CDDB8EF168287533FC514B7C|yjbI]-[gene|87124945A1CBF7990856FBEB9EAD25096DAC0868|yjbH]
description
[Pubmed|17293416]
regulation
induced by cell wall stress ([protein|2C6386E9A63F410558D168798D077DF91590F454|spx]) [pubmed|29271514]
regulatory mechanism
[protein|2C6386E9A63F410558D168798D077DF91590F454|spx]: activation, [pubmed|29271514], in [regulon|protein:2C6386E9A63F410558D168798D077DF91590F454|spx regulon]
additional information
A [protein|search|ncRNA] is predicted between [gene|138DC46C976BAA18893B70DF040BA1BB2FA0A77C|yizD] and [gene|87124945A1CBF7990856FBEB9EAD25096DAC0868|yjbH] [PubMed|20525796]
Open in new tab

[gene|948BD57CC45915C7CDDB8EF168287533FC514B7C|yjbI]→[gene|87124945A1CBF7990856FBEB9EAD25096DAC0868|yjbH]

2023-02-01 13:38:16

Jstuelk

38

8d759f27656c90574831e1b626e779b9f73bc246

DDE7E06D5F7C0635D74C904968069D697AA98842

Biological materials
Mutant
GP2645 ([gene|87124945A1CBF7990856FBEB9EAD25096DAC0868|yjbH]::''erm''), available in [wiki|Jörg Stülke]'s lab
BKE11550 (''[gene|87124945A1CBF7990856FBEB9EAD25096DAC0868|yjbH]''::''erm'', available in the BGSC and in [wiki|Jörg Stülke]'s lab) [pubmed|28189581]
BKE11550 ([gene|87124945A1CBF7990856FBEB9EAD25096DAC0868|yjbH]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE11550 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GTATAGCTCATGCTGATAGT,  downstream forward: _UP4_TAGCCGCAGGCGTGCATATG
BKK11550 ([gene|87124945A1CBF7990856FBEB9EAD25096DAC0868|yjbH]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK11550 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GTATAGCTCATGCTGATAGT,  downstream forward: _UP4_TAGCCGCAGGCGTGCATATG
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
labs
[wiki|Peter Zuber], Oregon Health and Science University, USA
[http://www.ogi.edu/people/dsp_person.cfm?person_id=411D6801-2A56-D16D-58A06B4480EDB9C7 Homepage]
[wiki|Claes von Wachenfeldt], Lund University, Sweden [http://aron.ldc.lu.se/kundwebb/cellorg/mibiol/research/wachen/index.htm Homepage]
References
Reviews
23375660,23479438,19609260,28748186
Original Publications
17293416,19074380,17908206,20525796,21378193,21947404,24417481,24942655,25353645,27191337,29271514,30982633,34181483,35638827

87124945A1CBF7990856FBEB9EAD25096DAC0868

Page visits: 3195

Time of last update: 2023-02-02 06:02:24

Author of last update: Jstuelk